Incidental Mutation 'RF028:Boc'
ID604245
Institutional Source Beutler Lab
Gene Symbol Boc
Ensembl Gene ENSMUSG00000022687
Gene Namebiregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF028 (G1)
Quality Score102.457
Status Not validated
Chromosome16
Chromosomal Location44485049-44558897 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAC to G at 44496433 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114634]
Predicted Effect probably null
Transcript: ENSMUST00000114634
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Boc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Boc APN 16 44492955 missense probably benign 0.00
IGL00981:Boc APN 16 44491801 missense probably damaging 0.99
IGL01820:Boc APN 16 44491872 missense possibly damaging 0.88
IGL03114:Boc APN 16 44486752 missense probably benign 0.38
IGL03195:Boc APN 16 44492821 missense probably damaging 0.99
R0006:Boc UTSW 16 44496449 missense probably benign 0.41
R0142:Boc UTSW 16 44490241 missense probably damaging 1.00
R0417:Boc UTSW 16 44520234 missense probably benign 0.16
R1066:Boc UTSW 16 44490684 critical splice acceptor site probably null
R1248:Boc UTSW 16 44520473 missense probably benign 0.03
R1438:Boc UTSW 16 44488746 splice site probably null
R1506:Boc UTSW 16 44503565 missense probably damaging 1.00
R1729:Boc UTSW 16 44496419 missense probably benign 0.00
R1784:Boc UTSW 16 44496419 missense probably benign 0.00
R2004:Boc UTSW 16 44501644 critical splice donor site probably null
R2441:Boc UTSW 16 44488623 missense probably damaging 1.00
R2863:Boc UTSW 16 44492960 missense probably benign 0.03
R3885:Boc UTSW 16 44487613 splice site probably benign
R4201:Boc UTSW 16 44490618 missense probably damaging 1.00
R4239:Boc UTSW 16 44491884 missense probably damaging 1.00
R4382:Boc UTSW 16 44491182 missense probably damaging 1.00
R4384:Boc UTSW 16 44491182 missense probably damaging 1.00
R4385:Boc UTSW 16 44491182 missense probably damaging 1.00
R4684:Boc UTSW 16 44500380 missense probably benign 0.07
R4776:Boc UTSW 16 44487721 missense probably damaging 0.99
R4788:Boc UTSW 16 44500433 missense probably damaging 1.00
R4830:Boc UTSW 16 44490157 missense probably damaging 1.00
R5000:Boc UTSW 16 44490154 missense probably damaging 1.00
R5567:Boc UTSW 16 44492824 missense probably damaging 1.00
R5570:Boc UTSW 16 44492824 missense probably damaging 1.00
R5645:Boc UTSW 16 44499661 missense probably damaging 0.99
R5651:Boc UTSW 16 44521195 missense probably benign 0.00
R5881:Boc UTSW 16 44490651 missense probably damaging 1.00
R6021:Boc UTSW 16 44488654 missense probably benign 0.00
R6085:Boc UTSW 16 44488607 missense probably damaging 1.00
R6188:Boc UTSW 16 44499548 missense possibly damaging 0.67
R6295:Boc UTSW 16 44492348 missense probably benign 0.05
R6366:Boc UTSW 16 44487652 missense probably benign 0.04
R6626:Boc UTSW 16 44520440 missense possibly damaging 0.47
R6629:Boc UTSW 16 44492361 missense probably benign 0.11
R6707:Boc UTSW 16 44500616 missense possibly damaging 0.71
R6819:Boc UTSW 16 44492825 missense probably damaging 0.99
R6904:Boc UTSW 16 44491791 missense probably damaging 1.00
R7260:Boc UTSW 16 44490170 missense
R7353:Boc UTSW 16 44485737 missense unknown
R7458:Boc UTSW 16 44486756 missense
R7671:Boc UTSW 16 44491849 missense
R8283:Boc UTSW 16 44520437 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- CACTACGTAGTACAGGATGGGTG -3'
(R):5'- GGGCTCATCGTGATTTCAGG -3'

Sequencing Primer
(F):5'- TACAGGATGGGTGTCCGGC -3'
(R):5'- CAGGTGATCAGGGCCACTAAC -3'
Posted On2019-12-04