Incidental Mutation 'RF028:E4f1'
ID604247
Institutional Source Beutler Lab
Gene Symbol E4f1
Ensembl Gene ENSMUSG00000024137
Gene NameE4F transcription factor 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF028 (G1)
Quality Score206.458
Status Not validated
Chromosome17
Chromosomal Location24443778-24470313 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGC to CGCGGC at 24455190 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000056032] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably benign
Transcript: ENSMUST00000056032
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226654
Predicted Effect probably benign
Transcript: ENSMUST00000226754
Predicted Effect probably benign
Transcript: ENSMUST00000226941
Predicted Effect probably benign
Transcript: ENSMUST00000228882
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the GLI-Kruppel zinc finger family. The encoded protein is likely to be multi-functional, with both adenovirus E1A-regulated transcription factor and ubiquitin E3 ligase activities, including roles in cell cycle regulation and the ubiquitination of p53. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display early embryonic lethality with mitotic progression failure and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Gm8369 TG TGGGTGAG 19: 11,511,773 probably null Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in E4f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:E4f1 APN 17 24444234 missense probably damaging 0.99
IGL02306:E4f1 APN 17 24446929 missense probably damaging 1.00
IGL03219:E4f1 APN 17 24445445 critical splice donor site probably null
FR4342:E4f1 UTSW 17 24455197 unclassified probably benign
FR4737:E4f1 UTSW 17 24455192 unclassified probably benign
R0084:E4f1 UTSW 17 24444082 missense possibly damaging 0.79
R0179:E4f1 UTSW 17 24451437 missense possibly damaging 0.57
R1171:E4f1 UTSW 17 24451549 missense probably damaging 1.00
R1773:E4f1 UTSW 17 24446584 missense probably damaging 1.00
R4531:E4f1 UTSW 17 24445987 missense possibly damaging 0.56
R5243:E4f1 UTSW 17 24447318 missense probably damaging 1.00
R5430:E4f1 UTSW 17 24444970 missense probably damaging 1.00
R5543:E4f1 UTSW 17 24447362 missense possibly damaging 0.49
R5598:E4f1 UTSW 17 24447129 missense probably damaging 1.00
R5604:E4f1 UTSW 17 24444144 missense probably damaging 1.00
R5858:E4f1 UTSW 17 24445328 missense probably damaging 1.00
R6240:E4f1 UTSW 17 24444582 missense possibly damaging 0.54
R6703:E4f1 UTSW 17 24447131 missense probably damaging 1.00
R7108:E4f1 UTSW 17 24444578 missense probably damaging 0.96
R7122:E4f1 UTSW 17 24444834 nonsense probably null
R7240:E4f1 UTSW 17 24444325 missense probably damaging 1.00
R7604:E4f1 UTSW 17 24455233 missense unknown
R7648:E4f1 UTSW 17 24445448 missense probably benign 0.02
RF002:E4f1 UTSW 17 24455186 unclassified probably benign
RF011:E4f1 UTSW 17 24455186 unclassified probably benign
RF020:E4f1 UTSW 17 24455195 unclassified probably benign
RF023:E4f1 UTSW 17 24455183 unclassified probably benign
RF033:E4f1 UTSW 17 24455183 unclassified probably benign
RF035:E4f1 UTSW 17 24455190 unclassified probably benign
RF035:E4f1 UTSW 17 24455195 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGAGTTGTGAAGGTTTACAGACAC -3'
(R):5'- AAGCTCCACCTCTACTGACG -3'

Sequencing Primer
(F):5'- GGTTTACAGACACTCGAGTAGCC -3'
(R):5'- TCTACTGACGCGCTAGACC -3'
Posted On2019-12-04