Incidental Mutation 'RF028:Gm8369'
ID604249
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF028 (G1)
Quality Score151.467
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) TG to TGGGTGAG at 11511773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably null
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik GCTGTG GCTGTGCCTCCTGTG 1: 82,913,578 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCCGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCAGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
Arid1b C CGGG 17: 4,995,598 probably benign Het
Blm CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTACTCCTCCTCCTCCTCCTCCTCCT 7: 80,512,905 probably null Het
Boc GAC G 16: 44,496,433 probably null Het
Cacna1f GAG GAGAAG X: 7,620,060 probably benign Het
Cacna1f GAG GAGAAG X: 7,620,063 probably benign Het
Catsper2 ATCGCTTTCCTCGTTTTCG ATCG 2: 121,397,726 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
E4f1 CGC CGCGGC 17: 24,455,190 probably benign Het
Eps8 TCGCTC TCGCTCGCTC 6: 137,517,063 probably benign Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gab3 CTTCTT CTTATTCTT X: 75,000,000 probably null Het
Gab3 TCT TCTGCT X: 75,000,017 probably benign Het
Gabre CTC CTCTGGGTC X: 72,270,763 probably benign Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Hsdl2 CAGCTGCAG CAGCTGCAGCAGCAGCCATAGCTGCAG 4: 59,610,650 probably null Het
Iqcf4 TTTTCCTTTT TTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCGTTTCCTTTT 9: 106,570,614 probably benign Het
Kmt2e TTT TTTTATT 5: 23,478,509 probably benign Het
Kri1 CTCCTCCT C 9: 21,281,071 probably null Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lce1m GTTGCTGCCACTG GTTGCTGCCACTGTTGCTGCCACTG 3: 93,018,131 probably benign Het
Lor CGCCGCCT C 3: 92,081,899 probably null Het
Luzp1 A AGGTGGCCTCTTCAGG 4: 136,543,196 probably benign Het
Lypd8 CCAACA CCAACAGGTCCCTCGCCTCTGTTACCCCACAAATAAACAACA 11: 58,390,239 probably benign Het
Mn1 CAG CAGGAG 5: 111,419,711 probably benign Het
Nefh GGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGACTTGGCCTCACCTGTGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,012 probably benign Het
Nefh GGGGACTTGGCCTCACCTGGGGACTTGGCCTC GGGGACTTGGCCTCACCTTGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,029 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 AGAT AGATCCACGTTAGCAGTGAGGAGCAAGCTGCGAT 2: 119,627,578 probably benign Het
Nusap1 CAGTGAGGAGCAAGCTGAGA CAGTGAGGAGCAAGCTGAGATACACGTTAGTAGTGAGGAGCAAGCTGAGA 2: 119,627,591 probably benign Het
Phf20 CCCCCC CCCCCCGCCCCC 2: 156,304,623 probably benign Het
Ppp1r8 TCTCTCTCAC TC 4: 132,830,615 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 CGGGACCGGGCATTGCGGGACCGGGCATTGCGGG CGG 2: 156,096,130 probably null Het
Rpgrip1 GA GAGTA 14: 52,149,398 probably null Het
Tanc1 GTGAGCAGAAACCAGCATTTAGAGGGAACCGGTCCCTTCACTGCAGGAA G 2: 59,843,269 probably benign Het
Tfeb GCA GCATCA 17: 47,786,097 probably benign Het
Tgoln1 T TTGTCTTGTCAGAATCACCTCCTGG 6: 72,616,036 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCAGTCCCGCAAGGCCCGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tob1 CACA CACAACA 11: 94,214,451 probably benign Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,290 probably benign Het
Triobp CAGGACT CAGGACTGCCTGTGCCCAACGGAACAACCCAAGGACT 15: 78,967,039 probably benign Het
Zfhx3 AACAGCAGC AACAGCAGCTACAGCAGC 8: 108,956,096 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF033:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAATCCTGCTGTGACAG -3'
(R):5'- AGACCTCACTTCACTAACATAGGTG -3'

Sequencing Primer
(F):5'- CCAAATCCTGCTGTGACAGTGATG -3'
(R):5'- GTCAATTTGCATTCAAACTTCTTTGC -3'
Posted On2019-12-04