Incidental Mutation 'RF029:Krtap28-10'
ID604256
Institutional Source Beutler Lab
Gene Symbol Krtap28-10
Ensembl Gene ENSMUSG00000100190
Gene Namekeratin associated protein 28-10
Synonyms4733401N17Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF029 (G1)
Quality Score143.467
Status Not validated
Chromosome1
Chromosomal Location83041524-83042480 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CACAGCCACAGCCAC to CACAGCCACAGCCACAACAGCCACAGCCAC at 83042270 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473] [ENSMUST00000188323] [ENSMUST00000222567]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164473
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188323
Predicted Effect probably benign
Transcript: ENSMUST00000222567
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Krtap28-10
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042255 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042280 unclassified probably benign
RF001:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF008:Krtap28-10 UTSW 1 83042279 unclassified probably benign
RF012:Krtap28-10 UTSW 1 83042136 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042135 unclassified probably benign
RF013:Krtap28-10 UTSW 1 83042274 unclassified probably benign
RF014:Krtap28-10 UTSW 1 83042251 unclassified probably benign
RF016:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF017:Krtap28-10 UTSW 1 83042266 unclassified probably benign
RF018:Krtap28-10 UTSW 1 83042253 unclassified probably benign
RF019:Krtap28-10 UTSW 1 83042269 unclassified probably benign
RF023:Krtap28-10 UTSW 1 83042146 nonsense probably null
RF023:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042123 unclassified probably benign
RF024:Krtap28-10 UTSW 1 83042252 unclassified probably benign
RF025:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF026:Krtap28-10 UTSW 1 83042126 unclassified probably benign
RF027:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF028:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF032:Krtap28-10 UTSW 1 83042258 unclassified probably benign
RF034:Krtap28-10 UTSW 1 83042282 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042146 unclassified probably benign
RF035:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042145 unclassified probably benign
RF037:Krtap28-10 UTSW 1 83042286 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042128 unclassified probably benign
RF038:Krtap28-10 UTSW 1 83042257 unclassified probably benign
RF042:Krtap28-10 UTSW 1 83042125 unclassified probably benign
RF044:Krtap28-10 UTSW 1 83042131 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042143 unclassified probably benign
RF045:Krtap28-10 UTSW 1 83042261 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042138 unclassified probably benign
RF049:Krtap28-10 UTSW 1 83042285 unclassified probably benign
RF053:Krtap28-10 UTSW 1 83042278 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042130 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF055:Krtap28-10 UTSW 1 83042270 unclassified probably benign
RF058:Krtap28-10 UTSW 1 83042262 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042275 unclassified probably benign
RF059:Krtap28-10 UTSW 1 83042290 unclassified probably benign
RF061:Krtap28-10 UTSW 1 83042281 unclassified probably benign
RF064:Krtap28-10 UTSW 1 83042131 unclassified probably benign
Z1177:Krtap28-10 UTSW 1 83042159 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGCAGCAGCACTTCTTG -3'
(R):5'- AGGGCTCCTTGAAGCAAAGG -3'

Sequencing Primer
(F):5'- ACACTTCTGCTGGCAGC -3'
(R):5'- GCTCCTTGAAGCAAAGGCCATC -3'
Posted On2019-12-04