Incidental Mutation 'RF029:Ifi208'
ID 604257
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Name interferon activated gene 208
Synonyms Pydc3, E430029J22Rik, Pyr-rv1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF029 (G1)
Quality Score 212.458
Status Not validated
Chromosome 1
Chromosomal Location 173501241-173525961 bp(+) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) AGATG to AG at 173505262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
AlphaFold Q3V3Q4
Predicted Effect probably benign
Transcript: ENSMUST00000085876
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169857
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,529,858 (GRCm39) probably benign Het
Abca17 T TCCCTC 17: 24,506,701 (GRCm39) probably benign Het
Amot GGAGCAGCAA G X: 144,233,984 (GRCm39) probably benign Het
C1s1 CCCATGGCTC CC 6: 124,518,310 (GRCm39) probably null Het
Cacna1a CCA CCAACA 8: 85,365,353 (GRCm39) probably benign Het
Ccdc170 ACC ACCGCC 10: 4,511,026 (GRCm39) probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 86,922,483 (GRCm39) probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 86,922,495 (GRCm39) probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,327,753 (GRCm39) probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,821,419 (GRCm39) probably null Het
Eed C A 7: 89,604,240 (GRCm39) A411S probably benign Het
Exd2 CCACAGC CC 12: 80,522,720 (GRCm39) probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,643,236 (GRCm39) probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,526,005 (GRCm39) probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,824,352 (GRCm39) probably null Het
Gabre GGCTC GGCTCCTGCTC X: 71,313,665 (GRCm39) probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,938,248 (GRCm39) probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,755,850 (GRCm39) probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,060,268 (GRCm39) probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,179,976 (GRCm39) probably benign Het
Irag2 TG TGAGCACATGG 6: 145,119,516 (GRCm39) probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,019,991 (GRCm39) probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,339,372 (GRCm39) probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,339,381 (GRCm39) probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,458,075 (GRCm39) probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,458,086 (GRCm39) probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pnma8a CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,695,369 (GRCm39) probably null Het
Polr1has CG CCACCACCACCACCCCCCCCAGG 17: 37,275,963 (GRCm39) probably benign Het
Rasa2 CGC CGCAGC 9: 96,513,520 (GRCm39) probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 155,938,015 (GRCm39) probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,684,950 (GRCm39) probably null Het
Tcof1 CAG CAGAAG 18: 60,968,807 (GRCm39) probably benign Het
Tcof1 AGC AGCGGC 18: 60,968,817 (GRCm39) probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,673,172 (GRCm39) probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 109,682,724 (GRCm39) probably benign Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173,506,604 (GRCm39) critical splice donor site probably null
IGL00725:Ifi208 APN 1 173,510,427 (GRCm39) missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173,506,597 (GRCm39) missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173,510,856 (GRCm39) missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173,506,508 (GRCm39) missense probably benign 0.15
IGL02829:Ifi208 APN 1 173,510,406 (GRCm39) missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173,506,507 (GRCm39) missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173,510,817 (GRCm39) missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173,505,264 (GRCm39) small deletion probably benign
FR4340:Ifi208 UTSW 1 173,505,264 (GRCm39) small deletion probably benign
FR4342:Ifi208 UTSW 1 173,505,264 (GRCm39) small deletion probably benign
R0022:Ifi208 UTSW 1 173,510,612 (GRCm39) missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173,511,047 (GRCm39) missense probably benign 0.08
R0734:Ifi208 UTSW 1 173,510,901 (GRCm39) missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173,510,262 (GRCm39) missense probably benign 0.06
R1070:Ifi208 UTSW 1 173,510,610 (GRCm39) missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173,510,804 (GRCm39) missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173,523,220 (GRCm39) missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173,505,476 (GRCm39) missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173,523,136 (GRCm39) critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173,510,438 (GRCm39) missense possibly damaging 0.93
R4175:Ifi208 UTSW 1 173,510,267 (GRCm39) missense probably benign 0.01
R4235:Ifi208 UTSW 1 173,510,477 (GRCm39) missense probably benign 0.06
R4749:Ifi208 UTSW 1 173,523,180 (GRCm39) missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173,510,403 (GRCm39) missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173,505,549 (GRCm39) intron probably benign
R5138:Ifi208 UTSW 1 173,518,239 (GRCm39) missense probably null 0.29
R5210:Ifi208 UTSW 1 173,510,831 (GRCm39) missense probably benign
R5304:Ifi208 UTSW 1 173,511,174 (GRCm39) missense probably benign
R6126:Ifi208 UTSW 1 173,505,274 (GRCm39) missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173,510,589 (GRCm39) missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173,510,444 (GRCm39) missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173,523,220 (GRCm39) nonsense probably null
R7972:Ifi208 UTSW 1 173,506,556 (GRCm39) missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173,510,242 (GRCm39) missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173,511,075 (GRCm39) missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173,510,844 (GRCm39) missense possibly damaging 0.85
R8794:Ifi208 UTSW 1 173,523,370 (GRCm39) missense possibly damaging 0.71
R8823:Ifi208 UTSW 1 173,511,102 (GRCm39) missense probably damaging 0.99
R8849:Ifi208 UTSW 1 173,506,184 (GRCm39) intron probably benign
R9127:Ifi208 UTSW 1 173,523,400 (GRCm39) missense probably benign 0.02
R9225:Ifi208 UTSW 1 173,518,294 (GRCm39) missense possibly damaging 0.85
R9336:Ifi208 UTSW 1 173,510,394 (GRCm39) missense probably damaging 0.99
R9487:Ifi208 UTSW 1 173,510,961 (GRCm39) missense probably damaging 0.99
RF027:Ifi208 UTSW 1 173,505,262 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCCCACAGTGGCACAGTTAG -3'
(R):5'- CTGCAAGTTCTGGAATGTCTTCAC -3'

Sequencing Primer
(F):5'- GTGGCACAGTTAGTAATCATGCTCC -3'
(R):5'- AGTTCTGGAATGTCTTCACATACTTC -3'
Posted On 2019-12-04