Incidental Mutation 'RF029:Defb22'
ID604262
Institutional Source Beutler Lab
Gene Symbol Defb22
Ensembl Gene ENSMUSG00000027468
Gene Namedefensin beta 22
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF029 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location152485663-152490138 bp(-) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) GCGGCA to GCGGCAGAGCTGGCCTTTGCGGCA at 152485833 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028966]
Predicted Effect probably benign
Transcript: ENSMUST00000028966
SMART Domains Protein: ENSMUSP00000028966
Gene: ENSMUSG00000027468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Defensin_beta_2 26 59 4e-11 PFAM
low complexity region 89 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Defb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Defb22 APN 2 152486079 missense possibly damaging 0.93
IGL02040:Defb22 APN 2 152490056 missense possibly damaging 0.83
IGL03159:Defb22 APN 2 152490075 missense probably benign 0.00
R5153:Defb22 UTSW 2 152485802 missense unknown
R5387:Defb22 UTSW 2 152485906 missense unknown
R6141:Defb22 UTSW 2 152485802 missense unknown
R7153:Defb22 UTSW 2 152485920 missense unknown
R7385:Defb22 UTSW 2 152486197 missense probably damaging 0.99
R7650:Defb22 UTSW 2 152486103 missense probably benign 0.40
R7671:Defb22 UTSW 2 152486030 missense unknown
RF013:Defb22 UTSW 2 152485831 small insertion probably benign
RF021:Defb22 UTSW 2 152485832 small insertion probably benign
RF025:Defb22 UTSW 2 152485823 small insertion probably benign
RF025:Defb22 UTSW 2 152485824 small insertion probably benign
RF034:Defb22 UTSW 2 152485832 small insertion probably benign
RF041:Defb22 UTSW 2 152485823 small insertion probably benign
RF043:Defb22 UTSW 2 152485833 small insertion probably benign
RF062:Defb22 UTSW 2 152485825 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGAAATCAACACTGACTTAGGCC -3'
(R):5'- GCGGTGGACAGAATTCAGATAATC -3'

Sequencing Primer
(F):5'- AACACTGACTTAGGCCTCTTGG -3'
(R):5'- TCAGATAATCTTGTCACAGCAGG -3'
Posted On2019-12-04