Incidental Mutation 'RF029:Lkaaear1'
Institutional Source Beutler Lab
Gene Symbol Lkaaear1
Ensembl Gene ENSMUSG00000045794
Gene NameLKAAEAR motif containing 1 (IKAAEAR murine motif)
SynonymsLOC277496, 4930526D03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #RF029 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location181696793-181698442 bp(-) (GRCm38)
Type of Mutationunclassified
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002532] [ENSMUST00000052416] [ENSMUST00000108769] [ENSMUST00000108771] [ENSMUST00000108772] [ENSMUST00000108776] [ENSMUST00000108779]
Predicted Effect probably benign
Transcript: ENSMUST00000002532
SMART Domains Protein: ENSMUSP00000002532
Gene: ENSMUSG00000002458

low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052416
SMART Domains Protein: ENSMUSP00000061134
Gene: ENSMUSG00000045794

low complexity region 16 31 N/A INTRINSIC
Pfam:LKAAEAR 44 179 1.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108769
SMART Domains Protein: ENSMUSP00000104400
Gene: ENSMUSG00000002458

low complexity region 39 51 N/A INTRINSIC
Pfam:RGS 90 160 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108771
SMART Domains Protein: ENSMUSP00000104402
Gene: ENSMUSG00000002458

low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108772
SMART Domains Protein: ENSMUSP00000104403
Gene: ENSMUSG00000002458

low complexity region 17 29 N/A INTRINSIC
RGS 68 184 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108776
SMART Domains Protein: ENSMUSP00000104406
Gene: ENSMUSG00000002458

low complexity region 39 51 N/A INTRINSIC
RGS 90 206 2.73e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108779
SMART Domains Protein: ENSMUSP00000104409
Gene: ENSMUSG00000002458

low complexity region 39 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132409
SMART Domains Protein: ENSMUSP00000116083
Gene: ENSMUSG00000045794

Pfam:LKAAEAR 1 91 7.2e-34 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Lkaaear1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Lkaaear1 APN 2 181697334 missense probably benign 0.00
IGL01508:Lkaaear1 APN 2 181697037 missense probably benign 0.09
FR4304:Lkaaear1 UTSW 2 181697579 unclassified probably benign
FR4340:Lkaaear1 UTSW 2 181697594 unclassified probably benign
FR4449:Lkaaear1 UTSW 2 181697571 unclassified probably benign
R3430:Lkaaear1 UTSW 2 181697531 missense probably benign 0.02
R4994:Lkaaear1 UTSW 2 181697583 nonsense probably null
R6683:Lkaaear1 UTSW 2 181697561 unclassified probably benign
R6684:Lkaaear1 UTSW 2 181697561 unclassified probably benign
R6685:Lkaaear1 UTSW 2 181697561 unclassified probably benign
RF007:Lkaaear1 UTSW 2 181697559 unclassified probably benign
RF007:Lkaaear1 UTSW 2 181697577 unclassified probably benign
RF022:Lkaaear1 UTSW 2 181697577 unclassified probably benign
RF029:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF033:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF036:Lkaaear1 UTSW 2 181697588 unclassified probably benign
RF049:Lkaaear1 UTSW 2 181697574 unclassified probably benign
RF052:Lkaaear1 UTSW 2 181697433 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04