Incidental Mutation 'RF029:Gm572'
ID604267
Institutional Source Beutler Lab
Gene Symbol Gm572
Ensembl Gene ENSMUSG00000070577
Gene Namepredicted gene 572
Synonymsb2b1167Clo, LOC230909
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #RF029 (G1)
Quality Score217.479
Status Not validated
Chromosome4
Chromosomal Location148643317-148671572 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGGGGGGGGGGGG to TGGGGG at 148671393 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105698]
Predicted Effect probably null
Transcript: ENSMUST00000105698
SMART Domains Protein: ENSMUSP00000101323
Gene: ENSMUSG00000070577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DUF4556 144 358 1.9e-117 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele show cardiovascular defects including double outlet right ventricle, dextrocardia and atrioventricular septal defects, heterotaxia with situs inversus totalis and right pulmonary isomerism, spleen hypoplasia, mid-line liver, and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Gm572
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Gm572 APN 4 148667392 missense possibly damaging 0.93
IGL01766:Gm572 APN 4 148654895 missense possibly damaging 0.53
IGL02670:Gm572 APN 4 148651228 missense probably benign
IGL02716:Gm572 APN 4 148654870 missense probably benign 0.01
PIT1430001:Gm572 UTSW 4 148671393 missense unknown
R1346:Gm572 UTSW 4 148654897 missense possibly damaging 0.96
R1546:Gm572 UTSW 4 148666819 missense possibly damaging 0.71
R1564:Gm572 UTSW 4 148651186 missense possibly damaging 0.53
R1672:Gm572 UTSW 4 148668509 missense possibly damaging 0.86
R2516:Gm572 UTSW 4 148664384 missense possibly damaging 0.93
R3852:Gm572 UTSW 4 148668872 missense possibly damaging 0.71
R4366:Gm572 UTSW 4 148654865 missense possibly damaging 0.85
R4884:Gm572 UTSW 4 148667362 missense possibly damaging 0.85
R4888:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5026:Gm572 UTSW 4 148654844 missense possibly damaging 0.92
R5121:Gm572 UTSW 4 148666845 critical splice donor site probably null
R5797:Gm572 UTSW 4 148666798 missense probably benign 0.02
R5988:Gm572 UTSW 4 148668507 missense possibly damaging 0.85
R6827:Gm572 UTSW 4 148658086 missense possibly damaging 0.96
R7709:Gm572 UTSW 4 148668951 missense probably damaging 0.98
R8298:Gm572 UTSW 4 148658093 missense possibly damaging 0.53
R8442:Gm572 UTSW 4 148658993 missense possibly damaging 0.53
RF030:Gm572 UTSW 4 148671393 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAGCCCCAAACTCGGAATTAG -3'
(R):5'- GTGTAAATCTTCCCAGGGAGG -3'

Sequencing Primer
(F):5'- TCGGAATTAGAAACAAAGACAAAGCC -3'
(R):5'- CAAAGTCCATCTCACGCTT -3'
Posted On2019-12-04