Incidental Mutation 'RF029:Fbrsl1'
ID 604268
Institutional Source Beutler Lab
Gene Symbol Fbrsl1
Ensembl Gene ENSMUSG00000043323
Gene Name fibrosin-like 1
Synonyms 2410025L10Rik, LOC381668
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # RF029 (G1)
Quality Score 217.468
Status Not validated
Chromosome 5
Chromosomal Location 110361754-110448503 bp(-) (GRCm38)
Type of Mutation small insertion (4 aa in frame mutation)
DNA Base Change (assembly) GCGTGTGCTGGT to GCGTGTGCTGGTTCGTGTGCTGGT at 110378139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056124] [ENSMUST00000069483] [ENSMUST00000196801] [ENSMUST00000198768] [ENSMUST00000198834]
AlphaFold E9Q9T0
Predicted Effect probably benign
Transcript: ENSMUST00000056124
SMART Domains Protein: ENSMUSP00000054613
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 125 329 3.1e-96 PFAM
low complexity region 464 480 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 528 542 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069483
SMART Domains Protein: ENSMUSP00000063879
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 476 493 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Pfam:Auts2 564 767 1.9e-95 PFAM
low complexity region 902 918 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
low complexity region 966 980 N/A INTRINSIC
low complexity region 981 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196801
SMART Domains Protein: ENSMUSP00000142625
Gene: ENSMUSG00000043323

low complexity region 6 30 N/A INTRINSIC
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 71 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
low complexity region 269 286 N/A INTRINSIC
low complexity region 293 308 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 377 410 N/A INTRINSIC
low complexity region 447 456 N/A INTRINSIC
low complexity region 489 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198768
SMART Domains Protein: ENSMUSP00000142379
Gene: ENSMUSG00000043323

low complexity region 17 38 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198834
SMART Domains Protein: ENSMUSP00000143147
Gene: ENSMUSG00000043323

low complexity region 3 16 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 82 100 N/A INTRINSIC
Pfam:Auts2 150 353 4.1e-107 PFAM
low complexity region 488 504 N/A INTRINSIC
low complexity region 522 537 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Fbrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Fbrsl1 APN 5 110378248 missense probably damaging 0.99
IGL01743:Fbrsl1 APN 5 110381640 missense probably damaging 0.98
IGL01910:Fbrsl1 APN 5 110363736 missense probably damaging 1.00
F5770:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
FR4342:Fbrsl1 UTSW 5 110378125 small insertion probably benign
FR4589:Fbrsl1 UTSW 5 110378150 small insertion probably benign
R0084:Fbrsl1 UTSW 5 110379515 missense probably damaging 0.99
R0126:Fbrsl1 UTSW 5 110396040 splice site probably benign
R0336:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R1196:Fbrsl1 UTSW 5 110374519 missense probably benign 0.21
R1712:Fbrsl1 UTSW 5 110447996 missense probably benign 0.01
R1998:Fbrsl1 UTSW 5 110376439 missense probably benign 0.43
R2081:Fbrsl1 UTSW 5 110371625 critical splice acceptor site probably null
R2108:Fbrsl1 UTSW 5 110378434 missense probably damaging 0.97
R4420:Fbrsl1 UTSW 5 110378986 missense possibly damaging 0.66
R4472:Fbrsl1 UTSW 5 110379066 start gained probably benign
R4931:Fbrsl1 UTSW 5 110379029 missense possibly damaging 0.89
R4994:Fbrsl1 UTSW 5 110447951 missense probably damaging 0.96
R5025:Fbrsl1 UTSW 5 110417901 missense probably damaging 0.99
R5084:Fbrsl1 UTSW 5 110379406 start gained probably benign
R5326:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5542:Fbrsl1 UTSW 5 110378441 missense probably damaging 1.00
R5590:Fbrsl1 UTSW 5 110381618 missense probably damaging 0.96
R6168:Fbrsl1 UTSW 5 110396056 missense probably damaging 0.97
R6234:Fbrsl1 UTSW 5 110378051 missense probably damaging 0.97
R6325:Fbrsl1 UTSW 5 110377407 missense probably damaging 1.00
R6661:Fbrsl1 UTSW 5 110378097 missense probably damaging 1.00
R7269:Fbrsl1 UTSW 5 110433014 missense probably benign 0.15
R7514:Fbrsl1 UTSW 5 110432933 missense probably benign 0.06
R7586:Fbrsl1 UTSW 5 110378154 missense probably damaging 0.99
R7791:Fbrsl1 UTSW 5 110448019 missense probably benign 0.00
R8108:Fbrsl1 UTSW 5 110378379 splice site probably null
R8182:Fbrsl1 UTSW 5 110378995 missense possibly damaging 0.46
R8679:Fbrsl1 UTSW 5 110378220 missense probably damaging 1.00
R9234:Fbrsl1 UTSW 5 110363384 missense probably benign 0.00
RF008:Fbrsl1 UTSW 5 110378118 small insertion probably benign
RF031:Fbrsl1 UTSW 5 110378151 small insertion probably benign
RF033:Fbrsl1 UTSW 5 110378125 small insertion probably benign
RF034:Fbrsl1 UTSW 5 110378149 small insertion probably benign
RF037:Fbrsl1 UTSW 5 110378151 nonsense probably null
RF061:Fbrsl1 UTSW 5 110378131 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378139 small insertion probably benign
RF063:Fbrsl1 UTSW 5 110378143 small insertion probably benign
RF064:Fbrsl1 UTSW 5 110378131 small insertion probably benign
V7582:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0018:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0019:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0020:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0021:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0022:Fbrsl1 UTSW 5 110371549 missense probably damaging 1.00
X0022:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0023:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0024:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0027:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0050:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0052:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0053:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0054:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0057:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0058:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0060:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0061:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0062:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0063:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0064:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0065:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0066:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
X0067:Fbrsl1 UTSW 5 110379426 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04