Incidental Mutation 'RF029:Reep1'
ID604269
Institutional Source Beutler Lab
Gene Symbol Reep1
Ensembl Gene ENSMUSG00000052852
Gene Namereceptor accessory protein 1
SynonymsD6Ertd253e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF029 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location71707561-71810710 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) CGCCA to CGCCAGCCA at 71707966 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121469] [ENSMUST00000212631] [ENSMUST00000212792]
Predicted Effect probably null
Transcript: ENSMUST00000121469
SMART Domains Protein: ENSMUSP00000112662
Gene: ENSMUSG00000052852

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 7 95 1.1e-35 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212631
Predicted Effect probably null
Transcript: ENSMUST00000212792
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spastic paraplegia in aged mice with reduced ER complexity in cortical motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Reep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Reep1 APN 6 71773288 missense probably damaging 1.00
IGL03057:Reep1 APN 6 71807781 splice site probably benign
R1596:Reep1 UTSW 6 71756437 critical splice donor site probably null
R1899:Reep1 UTSW 6 71780797 missense probably benign 0.32
R2201:Reep1 UTSW 6 71773294 missense probably damaging 1.00
R2252:Reep1 UTSW 6 71756442 splice site probably null
R3787:Reep1 UTSW 6 71795215 missense probably damaging 0.98
R4760:Reep1 UTSW 6 71708001 missense possibly damaging 0.67
R5657:Reep1 UTSW 6 71761374 missense possibly damaging 0.89
R6619:Reep1 UTSW 6 71807842 utr 3 prime probably benign
R6659:Reep1 UTSW 6 71773195 missense probably damaging 1.00
R7080:Reep1 UTSW 6 71780765 missense possibly damaging 0.81
R7299:Reep1 UTSW 6 71761389 missense probably benign 0.02
R7730:Reep1 UTSW 6 71780741 missense possibly damaging 0.64
RF019:Reep1 UTSW 6 71707969 start codon destroyed probably null
RF023:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF032:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF042:Reep1 UTSW 6 71707966 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CACCACACGGTTTCACAAGGAG -3'
(R):5'- CTAAATTTAGCGACCGCCGG -3'

Sequencing Primer
(F):5'- CTGGGACGATCGGAGCAG -3'
(R):5'- CCGGGTATTAATAGCTAGCGACC -3'
Posted On2019-12-04