Incidental Mutation 'RF029:C1s1'
ID604270
Institutional Source Beutler Lab
Gene Symbol C1s1
Ensembl Gene ENSMUSG00000038521
Gene Namecomplement component 1, s subcomponent 1
SynonymsC1s
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #RF029 (G1)
Quality Score214.458
Status Not validated
Chromosome6
Chromosomal Location124530345-124542359 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) CCCATGGCTC to CC at 124541351 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159463] [ENSMUST00000160505] [ENSMUST00000162443] [ENSMUST00000162844]
Predicted Effect probably null
Transcript: ENSMUST00000159463
SMART Domains Protein: ENSMUSP00000125439
Gene: ENSMUSG00000038521

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160505
SMART Domains Protein: ENSMUSP00000125531
Gene: ENSMUSG00000038521

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162443
SMART Domains Protein: ENSMUSP00000125712
Gene: ENSMUSG00000038521

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162844
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in C1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:C1s1 APN 6 124541334 missense probably benign 0.02
IGL02590:C1s1 APN 6 124531276 missense possibly damaging 0.89
IGL02968:C1s1 APN 6 124540351 missense probably damaging 0.99
IGL03301:C1s1 APN 6 124541324 splice site probably benign
BB008:C1s1 UTSW 6 124533400 missense probably damaging 1.00
BB018:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R0105:C1s1 UTSW 6 124541318 splice site probably benign
R0396:C1s1 UTSW 6 124533354 missense probably benign 0.03
R0759:C1s1 UTSW 6 124531437 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1396:C1s1 UTSW 6 124531051 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1627:C1s1 UTSW 6 124537480 missense probably damaging 1.00
R1855:C1s1 UTSW 6 124534356 critical splice donor site probably null
R2010:C1s1 UTSW 6 124537394 missense probably damaging 1.00
R2349:C1s1 UTSW 6 124541473 start gained probably benign
R4544:C1s1 UTSW 6 124531540 missense probably benign 0.31
R4661:C1s1 UTSW 6 124536490 missense probably benign 0.22
R5383:C1s1 UTSW 6 124534401 missense probably damaging 1.00
R5687:C1s1 UTSW 6 124540950 missense probably benign 0.01
R5846:C1s1 UTSW 6 124540953 missense possibly damaging 0.93
R6289:C1s1 UTSW 6 124531176 missense probably damaging 0.99
R6410:C1s1 UTSW 6 124531158 missense probably damaging 1.00
R6983:C1s1 UTSW 6 124540896 missense possibly damaging 0.93
R7931:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R8141:C1s1 UTSW 6 124531362 missense probably damaging 1.00
R8341:C1s1 UTSW 6 124531156 missense probably damaging 1.00
R8399:C1s1 UTSW 6 124535293 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAAGGTTCATATCTGAGCTCTTTC -3'
(R):5'- GACCATTCCTGACAGGTACC -3'

Sequencing Primer
(F):5'- GGAAATCACATACAACAGGCCTGTG -3'
(R):5'- CCTGACAGGTACCTATTTCTATGG -3'
Posted On2019-12-04