Incidental Mutation 'RF029:Pnmal1'
ID 604273
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene Name PNMA-like 1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # RF029 (G1)
Quality Score 217.496
Status Not validated
Chromosome 7
Chromosomal Location 16959679-16964607 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) CAACATC to CAACATCTCATGATGCACCTGCTTAAACATC at 16961444 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
AlphaFold Q80VM8
Predicted Effect probably null
Transcript: ENSMUST00000038163
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141

Pfam:PNMA 5 364 6.9e-108 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R1426:Pnmal1 UTSW 7 16960984 missense possibly damaging 0.56
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R2404:Pnmal1 UTSW 7 16960391 missense probably damaging 1.00
R3415:Pnmal1 UTSW 7 16960954 missense possibly damaging 0.74
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
R7756:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R7758:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R8687:Pnmal1 UTSW 7 16960595 missense probably damaging 0.99
R8854:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
RF007:Pnmal1 UTSW 7 16961424 small insertion probably benign
RF009:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF020:Pnmal1 UTSW 7 16961451 small insertion probably benign
RF022:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF039:Pnmal1 UTSW 7 16961444 small insertion probably benign
RF041:Pnmal1 UTSW 7 16961444 nonsense probably null
RF046:Pnmal1 UTSW 7 16961423 small insertion probably benign
RF047:Pnmal1 UTSW 7 16961423 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04