Incidental Mutation 'RF029:Eed'
ID604274
Institutional Source Beutler Lab
Gene Symbol Eed
Ensembl Gene ENSMUSG00000030619
Gene Nameembryonic ectoderm development
Synonymsl7Rn5, l(7)5Rn
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #RF029 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location89954654-89980983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89955032 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 411 (A411S)
Ref Sequence ENSEMBL: ENSMUSP00000102853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107234] [ENSMUST00000207980]
PDB Structure
Structural basis of EZH2 recognition by EED [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000107234
AA Change: A411S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102853
Gene: ENSMUSG00000030619
AA Change: A411S

DomainStartEndE-ValueType
WD40 81 125 1.43e1 SMART
WD40 131 176 2.04e2 SMART
WD40 179 219 1.3e-7 SMART
WD40 222 264 1.61e-3 SMART
WD40 295 332 7.1e1 SMART
Blast:WD40 349 390 1e-17 BLAST
WD40 397 438 4.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207980
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are dwarfed and their coat color is dilute. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Eed
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Eed APN 7 89969595 missense possibly damaging 0.71
IGL02232:Eed APN 7 89972285 missense probably damaging 1.00
IGL02740:Eed APN 7 89972256 missense possibly damaging 0.91
R0417:Eed UTSW 7 89971552 nonsense probably null
R1018:Eed UTSW 7 89967811 splice site probably benign
R1581:Eed UTSW 7 89980468 missense possibly damaging 0.53
R3959:Eed UTSW 7 89954941 missense probably benign 0.10
R4774:Eed UTSW 7 89964768 missense probably damaging 1.00
R5021:Eed UTSW 7 89972305 missense probably damaging 0.98
R5238:Eed UTSW 7 89976965 missense probably benign
R5561:Eed UTSW 7 89967793 missense probably damaging 1.00
R5959:Eed UTSW 7 89969627 missense probably damaging 1.00
R6223:Eed UTSW 7 89956287 missense probably damaging 1.00
R6391:Eed UTSW 7 89976941 missense probably benign 0.00
R6502:Eed UTSW 7 89977029 missense probably benign 0.00
R7021:Eed UTSW 7 89980519 missense possibly damaging 0.53
R7054:Eed UTSW 7 89964727 critical splice donor site probably null
R7056:Eed UTSW 7 89970356 missense possibly damaging 0.54
R7808:Eed UTSW 7 89956333 missense probably benign 0.04
R7836:Eed UTSW 7 89980814 start gained probably benign
RF030:Eed UTSW 7 89955032 missense probably benign
Z1177:Eed UTSW 7 89980514 missense probably benign 0.01
Z1177:Eed UTSW 7 89980515 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTAAATGCTCTATGTGCCC -3'
(R):5'- GAAATTTGAGAATGAATCCTTGGGG -3'

Sequencing Primer
(F):5'- TGTGCCCTTACTAGCAAGATAC -3'
(R):5'- TGGCTGTCCTGGAACTCAGAAATC -3'
Posted On2019-12-04