Incidental Mutation 'RF029:Exd2'
ID604284
Institutional Source Beutler Lab
Gene Symbol Exd2
Ensembl Gene ENSMUSG00000032705
Gene Nameexonuclease 3'-5' domain containing 2
Synonyms4930539P14Rik, Exdl2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #RF029 (G1)
Quality Score217.468
Status Not validated
Chromosome12
Chromosomal Location80463095-80500227 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCACAGC to CC at 80475946 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038185] [ENSMUST00000219272]
Predicted Effect probably null
Transcript: ENSMUST00000038185
SMART Domains Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 72 N/A INTRINSIC
35EXOc 105 291 3.8e-10 SMART
Blast:HNHc 438 492 1e-6 BLAST
low complexity region 517 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219272
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Exd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Exd2 APN 12 80476166 missense probably damaging 1.00
IGL00546:Exd2 APN 12 80480547 missense probably benign 0.05
IGL02964:Exd2 APN 12 80480528 missense probably damaging 0.99
IGL03036:Exd2 APN 12 80489411 missense probably damaging 1.00
R0304:Exd2 UTSW 12 80491240 unclassified probably benign
R0436:Exd2 UTSW 12 80490770 splice site probably benign
R1290:Exd2 UTSW 12 80484326 missense probably benign 0.00
R1772:Exd2 UTSW 12 80489479 missense probably benign 0.00
R2102:Exd2 UTSW 12 80480603 missense possibly damaging 0.78
R2104:Exd2 UTSW 12 80496801 missense probably benign 0.01
R2408:Exd2 UTSW 12 80484241 splice site probably benign
R3693:Exd2 UTSW 12 80480693 missense probably damaging 1.00
R4748:Exd2 UTSW 12 80480576 missense probably damaging 1.00
R4773:Exd2 UTSW 12 80475818 missense possibly damaging 0.46
R5022:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5057:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5179:Exd2 UTSW 12 80484344 missense probably damaging 1.00
R5377:Exd2 UTSW 12 80489448 missense probably damaging 1.00
R7246:Exd2 UTSW 12 80480535 missense probably damaging 1.00
R7761:Exd2 UTSW 12 80475772 missense probably damaging 0.98
R7776:Exd2 UTSW 12 80492560 missense probably damaging 1.00
R8032:Exd2 UTSW 12 80489653 missense probably benign 0.00
R8420:Exd2 UTSW 12 80475997 missense probably benign
RF013:Exd2 UTSW 12 80475932 frame shift probably null
RF015:Exd2 UTSW 12 80475917 intron probably benign
RF022:Exd2 UTSW 12 80475917 intron probably benign
RF023:Exd2 UTSW 12 80475915 intron probably benign
RF025:Exd2 UTSW 12 80475955 intron probably benign
RF035:Exd2 UTSW 12 80475900 intron probably benign
RF035:Exd2 UTSW 12 80475955 intron probably benign
RF039:Exd2 UTSW 12 80475941 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTAGGATCAGTGAAATGCTTTCC -3'
(R):5'- GCTGGATTTGATTCCACTCTGC -3'

Sequencing Primer
(F):5'- TGCTTTCCTAAAAAGTGAAAGGC -3'
(R):5'- GCCTCCTGAGATACCGTCAC -3'
Posted On2019-12-04