Incidental Mutation 'RF029:Tcof1'
ID604288
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF029 (G1)
Quality Score165.468
Status Not validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CAG to CAGAAG at 60835735 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163446] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172] [ENSMUST00000177343]
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175934
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176630
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177343
SMART Domains Protein: ENSMUSP00000135295
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2913:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 splice site probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
R7467:Tcof1 UTSW 18 60831905 missense unknown
R7536:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7804:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7818:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7863:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8006:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8007:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8008:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8063:Tcof1 UTSW 18 60838762 missense probably damaging 1.00
R8192:Tcof1 UTSW 18 60843303 missense probably damaging 1.00
R8200:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8203:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8204:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8207:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8217:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8300:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8517:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R8518:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
RF001:Tcof1 UTSW 18 60835739 unclassified probably benign
RF007:Tcof1 UTSW 18 60833568 small insertion probably benign
RF009:Tcof1 UTSW 18 60835743 unclassified probably benign
RF010:Tcof1 UTSW 18 60835744 unclassified probably benign
RF011:Tcof1 UTSW 18 60835739 unclassified probably benign
RF013:Tcof1 UTSW 18 60835743 unclassified probably benign
RF015:Tcof1 UTSW 18 60833584 small insertion probably benign
RF016:Tcof1 UTSW 18 60833575 small insertion probably benign
RF022:Tcof1 UTSW 18 60835735 unclassified probably benign
RF024:Tcof1 UTSW 18 60835738 unclassified probably benign
RF027:Tcof1 UTSW 18 60835736 unclassified probably benign
RF029:Tcof1 UTSW 18 60835745 unclassified probably benign
RF030:Tcof1 UTSW 18 60833568 small insertion probably benign
RF030:Tcof1 UTSW 18 60833574 small insertion probably benign
RF030:Tcof1 UTSW 18 60835723 unclassified probably benign
RF031:Tcof1 UTSW 18 60833565 small insertion probably benign
RF031:Tcof1 UTSW 18 60835745 unclassified probably benign
RF035:Tcof1 UTSW 18 60833553 small insertion probably benign
RF036:Tcof1 UTSW 18 60828408 small insertion probably benign
RF036:Tcof1 UTSW 18 60835736 unclassified probably benign
RF038:Tcof1 UTSW 18 60833566 small insertion probably benign
RF040:Tcof1 UTSW 18 60828408 small insertion probably benign
RF040:Tcof1 UTSW 18 60833583 small insertion probably benign
RF041:Tcof1 UTSW 18 60833572 small insertion probably benign
RF041:Tcof1 UTSW 18 60833576 small insertion probably benign
RF043:Tcof1 UTSW 18 60833572 small insertion probably benign
RF050:Tcof1 UTSW 18 60833579 small insertion probably benign
RF051:Tcof1 UTSW 18 60833579 small insertion probably benign
RF053:Tcof1 UTSW 18 60835747 unclassified probably benign
RF056:Tcof1 UTSW 18 60833575 small insertion probably benign
RF057:Tcof1 UTSW 18 60833564 small insertion probably benign
RF057:Tcof1 UTSW 18 60833565 small insertion probably benign
RF057:Tcof1 UTSW 18 60833566 small insertion probably benign
RF057:Tcof1 UTSW 18 60833571 small insertion probably benign
RF060:Tcof1 UTSW 18 60835744 unclassified probably benign
RF060:Tcof1 UTSW 18 60835747 unclassified probably benign
RF063:Tcof1 UTSW 18 60833573 small insertion probably benign
RF064:Tcof1 UTSW 18 60833571 small insertion probably benign
RF064:Tcof1 UTSW 18 60833574 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTCTAGAATGGGCCCTCTTCAG -3'
(R):5'- AAGGCTCTTCATGTGCTGCATC -3'

Sequencing Primer
(F):5'- AGGAGTTCTCCATCACACAGTGG -3'
(R):5'- CTGCTTCTAGGTGAAATCTCCAG -3'
Posted On2019-12-04