Incidental Mutation 'RF029:Amot'
ID604291
Institutional Source Beutler Lab
Gene Symbol Amot
Ensembl Gene ENSMUSG00000041688
Gene Nameangiomotin
SynonymsD0Kist1, E230009N18Rik, Sii6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #RF029 (G1)
Quality Score217.982
Status Not validated
ChromosomeX
Chromosomal Location145446425-145505181 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGAGCAGCAA to G at 145450988 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000112835] [ENSMUST00000112836]
Predicted Effect probably benign
Transcript: ENSMUST00000112835
SMART Domains Protein: ENSMUSP00000108454
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
coiled coil region 20 61 N/A INTRINSIC
internal_repeat_1 75 95 9.29e-5 PROSPERO
low complexity region 140 149 N/A INTRINSIC
low complexity region 175 186 N/A INTRINSIC
Pfam:Angiomotin_C 189 398 1.4e-100 PFAM
low complexity region 426 442 N/A INTRINSIC
SCOP:d1gkub1 513 546 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112836
SMART Domains Protein: ENSMUSP00000108455
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
internal_repeat_1 152 207 2.13e-5 PROSPERO
low complexity region 321 336 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
coiled coil region 409 450 N/A INTRINSIC
Blast:PAC 452 493 6e-12 BLAST
low complexity region 529 538 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Pfam:Angiomotin_C 578 785 6.1e-97 PFAM
low complexity region 815 831 N/A INTRINSIC
low complexity region 862 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125271
SMART Domains Protein: ENSMUSP00000116189
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
low complexity region 124 139 N/A INTRINSIC
low complexity region 150 168 N/A INTRINSIC
coiled coil region 211 252 N/A INTRINSIC
Blast:PAC 255 296 6e-12 BLAST
low complexity region 332 341 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Pfam:Angiomotin_C 381 588 2e-97 PFAM
low complexity region 618 634 N/A INTRINSIC
low complexity region 665 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138187
SMART Domains Protein: ENSMUSP00000117777
Gene: ENSMUSG00000041688

DomainStartEndE-ValueType
low complexity region 140 155 N/A INTRINSIC
low complexity region 166 184 N/A INTRINSIC
coiled coil region 227 268 N/A INTRINSIC
Blast:PAC 271 312 5e-12 BLAST
low complexity region 348 357 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Pfam:Angiomotin_C 397 604 1.1e-97 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.2%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null mutation exhibit impaired migration into proximal extraembryonic regions resulting in furrows of visceral endoderm at the junction of embryonic and extraembryonic regions, vascular insufficiency in the intersomitic region, dilated vessels in the brain and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430401F13Rik GGTGGCCAG GGTGGCCAGCAAAAACAGAAAGGAAAAAGTGGCCAG 6: 131,552,895 probably benign Het
Abca17 T TCCCTC 17: 24,287,727 probably benign Het
C1s1 CCCATGGCTC CC 6: 124,541,351 probably null Het
Cacna1a CCA CCAACA 8: 84,638,724 probably benign Het
Ccdc170 ACC ACCGCC 10: 4,561,026 probably benign Het
Cyb5r4 CAGA CAGAGACACTGACCAGGGATGTGATAGA 9: 87,040,430 probably benign Het
Cyb5r4 CCAGGGA CCAGGGATGTGACAGACACACTGCACAGGGA 9: 87,040,442 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Dnmt1 CGGAGCACAGTTCCTACCTCGTT CGGAGCACAGTTCCTACCTCGTTTTGGGGGAGGAGCACAGTTCCTACCTCGTT 9: 20,910,123 probably null Het
Eed C A 7: 89,955,032 A411S probably benign Het
Exd2 CCACAGC CC 12: 80,475,946 probably null Het
Fam171b GCAGC GCAGCATCAGC 2: 83,812,892 probably benign Het
Fbrsl1 GCGTGTGCTGGT GCGTGTGCTGGTTCGTGTGCTGGT 5: 110,378,139 probably benign Het
Fsip2 TAGATGTGAAACCCTTAGAGGTAAGATGTGAAACTCTTAGAGGTAAGA TAGATGTGAAACTCTTAGAGGTAAGA 2: 82,994,008 probably null Het
Gabre GGCTC GGCTCCTGCTC X: 72,270,059 probably benign Het
Gm47955 G GTTGTGGCTT 1: 82,960,527 probably benign Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Hic1 CGGGGGGGGGG CGGGGGGG 11: 75,169,442 probably benign Het
Ifi208 AGATG AG 1: 173,677,696 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Krtap28-10 CACAGCCACAGCCAC CACAGCCACAGCCACAACAGCCACAGCCAC 1: 83,042,270 probably benign Het
Lkaaear1 GCTCCAGCTCCAGCTCCAGCTCCA GCTCCAGCTCCACCTCCAGCTCCAGCTCCAGCTCCA 2: 181,697,579 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTACAGCTCCAGCT 2: 181,697,588 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Nusap1 TGAGGAGCAAGCTGAGA TGAGGAGCAAGCTGAGATACACGTTAGCTGGGAGGAGCAAGCTGAGA 2: 119,627,594 probably benign Het
Nusap1 CTGAGA CTGAGATACACGTTAGCAGTGAGGAGCAAGATGAGA 2: 119,627,605 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTAAACATC 7: 16,961,444 probably null Het
Rasa2 CGC CGCAGC 9: 96,631,467 probably benign Het
Rbm12 TATTGCGGGACCAGGTATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC 2: 156,096,095 probably benign Het
Reep1 CGCCA CGCCAGCCA 6: 71,707,966 probably null Het
Tcof1 CAG CAGAAG 18: 60,835,735 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Trappc9 GCTGCTGCT GCTGCTGCTGCTGCTTCTGCTGCT 15: 72,801,323 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Znrd1as CG CCACCACCACCACCCCCCCCAGG 17: 36,965,071 probably benign Het
Other mutations in Amot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Amot APN X 145487028 missense probably damaging 1.00
R1793:Amot UTSW X 145450589 unclassified probably benign
R2426:Amot UTSW X 145476291 missense probably damaging 1.00
R4536:Amot UTSW X 145480142 missense probably benign 0.00
RF023:Amot UTSW X 145451003 unclassified probably benign
RF035:Amot UTSW X 145450988 unclassified probably benign
RF050:Amot UTSW X 145451003 unclassified probably benign
Z1177:Amot UTSW X 145480458 missense
Predicted Primers PCR Primer
(F):5'- GGAATCTGAACAGCAGCAGC -3'
(R):5'- CGATTGCAGCACCCAAACTG -3'

Sequencing Primer
(F):5'- GCAGCAGCTGGAGAGAC -3'
(R):5'- CTGAACGTGGACCGGAATC -3'
Posted On2019-12-04