Incidental Mutation 'RF030:Il2'
ID 604296
Institutional Source Beutler Lab
Gene Symbol Il2
Ensembl Gene ENSMUSG00000027720
Gene Name interleukin 2
Synonyms IL-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF030 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 37174862-37180103 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GG to GGGCTTGAAGTGTG at 37179991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029275]
AlphaFold P04351
Predicted Effect probably benign
Transcript: ENSMUST00000029275
SMART Domains Protein: ENSMUSP00000029275
Gene: ENSMUSG00000027720

IL2 1 168 4.75e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147773
SMART Domains Protein: ENSMUSP00000121015
Gene: ENSMUSG00000027719

Pfam:A_deamin 1 176 1.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants develop adult onset autoimmune disease, with 50% mortality by 9 weeks due to hemolytic anemia. Survivors develop inflammatory bowl disease/colitis. Immune system dysregulation and CD4+ T-cell overproduction may be responsible. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,475,254 (GRCm39) probably benign Het
AI837181 GGC GGCCGC 19: 5,475,263 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,693,966 (GRCm39) probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,693,980 (GRCm39) probably benign Het
AY761185 GGGCACTGTGG GGG 8: 21,433,916 (GRCm39) probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,523,384 (GRCm39) probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,810,151 (GRCm39) probably benign Het
Cul9 CCTC CCTCCTC 17: 46,811,795 (GRCm39) probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,466,607 (GRCm39) probably benign Het
Eed C A 7: 89,604,240 (GRCm39) A411S probably benign Het
Fer1l4 GGTC G 2: 155,887,449 (GRCm39) probably benign Het
Frem3 GATC GATCATC 8: 81,341,867 (GRCm39) probably benign Het
Gab3 CTTTT CT X: 74,043,583 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,632 (GRCm39) probably benign Het
Gab3 TTC TTCGTC X: 74,043,631 (GRCm39) probably benign Het
Gab3 TCT TCTCCT X: 74,043,614 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,611 (GRCm39) probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,325,037 (GRCm39) probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,755,850 (GRCm39) probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,646,090 (GRCm39) probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,108,241 (GRCm39) probably benign Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Irag2 TG TGAGCACATGG 6: 145,119,516 (GRCm39) probably benign Het
Irag2 ATTG ATTGAGCACGTTG 6: 145,119,514 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,285,802 (GRCm39) probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 92,925,448 (GRCm39) probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 92,925,651 (GRCm39) probably benign Het
Mamld1 CAG CAGTAG X: 70,162,434 (GRCm39) probably null Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,136,798 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,410 (GRCm39) probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,064,550 (GRCm39) probably null Het
Pdik1l C CCACCAA 4: 134,006,827 (GRCm39) probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,421,898 (GRCm39) probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,384,473 (GRCm39) probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,384,483 (GRCm39) probably benign Het
Six5 CGGA C 7: 18,828,725 (GRCm39) probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,968,795 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,038 (GRCm39) probably benign Het
Tfeb AGC AGCCGC 17: 48,097,036 (GRCm39) probably benign Het
Tfeb GCA GCACCA 17: 48,097,037 (GRCm39) probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,593,019 (GRCm39) probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 (GRCm39) probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,673,174 (GRCm39) probably benign Het
Tsen2 GGA GGACGA 6: 115,537,028 (GRCm39) probably benign Het
Wdr97 AGGAGGAGG AG 15: 76,247,365 (GRCm39) probably null Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Other mutations in Il2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Il2 APN 3 37,177,156 (GRCm39) missense possibly damaging 0.64
IGL02047:Il2 APN 3 37,180,000 (GRCm39) missense probably benign 0.01
FR4304:Il2 UTSW 3 37,179,975 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,977 (GRCm39) unclassified probably benign
FR4737:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
FR4976:Il2 UTSW 3 37,179,978 (GRCm39) unclassified probably benign
R8805:Il2 UTSW 3 37,177,282 (GRCm39) missense possibly damaging 0.78
R9287:Il2 UTSW 3 37,179,988 (GRCm39) missense probably damaging 0.99
RF001:Il2 UTSW 3 37,179,911 (GRCm39) unclassified probably benign
RF023:Il2 UTSW 3 37,179,969 (GRCm39) unclassified probably benign
RF029:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF030:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF033:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
RF036:Il2 UTSW 3 37,179,976 (GRCm39) unclassified probably benign
RF038:Il2 UTSW 3 37,179,970 (GRCm39) nonsense probably null
RF039:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF041:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF043:Il2 UTSW 3 37,179,991 (GRCm39) unclassified probably benign
RF051:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,970 (GRCm39) unclassified probably benign
RF058:Il2 UTSW 3 37,179,966 (GRCm39) unclassified probably benign
RF061:Il2 UTSW 3 37,179,990 (GRCm39) unclassified probably benign
RF064:Il2 UTSW 3 37,179,913 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04