Incidental Mutation 'RF030:Lce1m'
Institutional Source Beutler Lab
Gene Symbol Lce1m
Ensembl Gene ENSMUSG00000027912
Gene Namelate cornified envelope 1M
SynonymsSprrl10, Lce5a, 1110059L13Rik
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF030 (G1)
Quality Score217.468
Status Not validated
Chromosomal Location93017810-93019060 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCTGCCAC to GCTGCCACAGCAACTTCTGCCAC at 93018344 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029521
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913

low complexity region 12 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107301
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913

Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Lce1m
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4342:Lce1m UTSW 3 93018247 unclassified probably benign
FR4449:Lce1m UTSW 3 93018152 unclassified probably benign
FR4589:Lce1m UTSW 3 93018268 unclassified probably benign
FR4976:Lce1m UTSW 3 93018148 unclassified probably benign
R1513:Lce1m UTSW 3 93018625 unclassified probably benign
R7621:Lce1m UTSW 3 93017870 utr 3 prime probably null
R7753:Lce1m UTSW 3 93018508 missense unknown
RF001:Lce1m UTSW 3 93018152 unclassified probably benign
RF001:Lce1m UTSW 3 93018269 unclassified probably benign
RF002:Lce1m UTSW 3 93018283 unclassified probably benign
RF002:Lce1m UTSW 3 93018299 unclassified probably benign
RF007:Lce1m UTSW 3 93018144 unclassified probably benign
RF009:Lce1m UTSW 3 93018131 unclassified probably benign
RF010:Lce1m UTSW 3 93018290 unclassified probably benign
RF015:Lce1m UTSW 3 93018148 unclassified probably benign
RF021:Lce1m UTSW 3 93018269 unclassified probably benign
RF021:Lce1m UTSW 3 93018295 unclassified probably benign
RF023:Lce1m UTSW 3 93018280 unclassified probably benign
RF026:Lce1m UTSW 3 93018138 unclassified probably benign
RF026:Lce1m UTSW 3 93018143 unclassified probably benign
RF028:Lce1m UTSW 3 93018131 unclassified probably benign
RF030:Lce1m UTSW 3 93018141 unclassified probably benign
RF037:Lce1m UTSW 3 93018300 unclassified probably benign
RF041:Lce1m UTSW 3 93018141 unclassified probably benign
RF042:Lce1m UTSW 3 93018139 unclassified probably benign
RF045:Lce1m UTSW 3 93018292 unclassified probably benign
RF046:Lce1m UTSW 3 93018293 unclassified probably benign
RF054:Lce1m UTSW 3 93018298 unclassified probably benign
RF059:Lce1m UTSW 3 93018329 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04