Incidental Mutation 'RF030:Hsdl2'
ID604301
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF030 (G1)
Quality Score214.512
Status Not validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) CCACAGCTGCAG to CCACAGCTGCAGCAGCAGACACAGCTGCAG at 59610647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000107528]
Predicted Effect probably benign
Transcript: ENSMUST00000030078
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1353:Hsdl2 UTSW 4 59596971 splice site probably null
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4247:Hsdl2 UTSW 4 59594417 missense probably damaging 1.00
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6435:Hsdl2 UTSW 4 59610668 missense unknown
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R6536:Hsdl2 UTSW 4 59610508 critical splice acceptor site probably null
R7156:Hsdl2 UTSW 4 59617653 missense possibly damaging 0.78
R7740:Hsdl2 UTSW 4 59612724 missense probably damaging 0.99
RF005:Hsdl2 UTSW 4 59610652 small insertion probably benign
RF013:Hsdl2 UTSW 4 59610657 small insertion probably benign
RF015:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF016:Hsdl2 UTSW 4 59610643 small insertion probably benign
RF020:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF023:Hsdl2 UTSW 4 59610644 small insertion probably benign
RF025:Hsdl2 UTSW 4 59610637 small insertion probably benign
RF026:Hsdl2 UTSW 4 59610655 small insertion probably benign
RF028:Hsdl2 UTSW 4 59610650 nonsense probably null
RF038:Hsdl2 UTSW 4 59610648 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610633 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610651 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610636 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610650 small insertion probably benign
RF056:Hsdl2 UTSW 4 59610647 frame shift probably null
RF059:Hsdl2 UTSW 4 59610658 small insertion probably benign
RF060:Hsdl2 UTSW 4 59610608 small insertion probably benign
RF061:Hsdl2 UTSW 4 59610657 small insertion probably benign
Z1176:Hsdl2 UTSW 4 59617706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTATACTGCCAAAACTTTAAGGC -3'
(R):5'- CTGAGAGTTCAAACTGATAGACAGC -3'

Sequencing Primer
(F):5'- CTGCCAAAACTTTAAGGCTCTTTATG -3'
(R):5'- GACAGCTTGTGTCGCTCTAACAAC -3'
Posted On2019-12-04