Incidental Mutation 'RF030:Tgoln1'
ID604306
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Nametrans-golgi network protein
SynonymsTtgn1, D6Ertd384e, TGN38, TGN38A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #RF030 (G1)
Quality Score217.468
Status Not validated
Chromosome6
Chromosomal Location72608432-72617000 bp(-) (GRCm38)
Type of Mutationsmall insertion (8 aa in frame mutation)
DNA Base Change (assembly) GCTTGCCAGAAT to GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT at 72616063 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
Predicted Effect probably benign
Transcript: ENSMUST00000070524
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72616090 missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72616252 missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72616072 missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72614113 missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72616351 small insertion probably benign
R0684:Tgoln1 UTSW 6 72615991 missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72614085 missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72616101 missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72615670 missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72615801 missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72615681 missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72616140 missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72616035 missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72616001 missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72616045 missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72616420 missense unknown
RF003:Tgoln1 UTSW 6 72616352 nonsense probably null
RF019:Tgoln1 UTSW 6 72616069 small insertion probably benign
RF023:Tgoln1 UTSW 6 72616080 small insertion probably benign
RF028:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF037:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF040:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF042:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF057:Tgoln1 UTSW 6 72616069 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCCCAGATTCAGTTTTGGAAGTAAG -3'
(R):5'- TCCAGTAAGGCGGAATCTGG -3'

Sequencing Primer
(F):5'- AGATTCAGTTTTGGAAGTAAGTGTTG -3'
(R):5'- GAATCTGGGCCGCGGAC -3'
Posted On2019-12-04