Incidental Mutation 'RF030:Idh2'
ID604314
Institutional Source Beutler Lab
Gene Symbol Idh2
Ensembl Gene ENSMUSG00000030541
Gene Nameisocitrate dehydrogenase 2 (NADP+), mitochondrial
SynonymsIdh-2, IDPm
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF030 (G1)
Quality Score104.467
Status Not validated
Chromosome7
Chromosomal Location80094846-80115392 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GGTCCCAG to GG at 80098329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107384] [ENSMUST00000125542] [ENSMUST00000134328] [ENSMUST00000164056] [ENSMUST00000206714]
Predicted Effect probably benign
Transcript: ENSMUST00000107384
SMART Domains Protein: ENSMUSP00000103007
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 441 5.32e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134070
Predicted Effect probably benign
Transcript: ENSMUST00000134328
SMART Domains Protein: ENSMUSP00000118184
Gene: ENSMUSG00000030541

DomainStartEndE-ValueType
Iso_dh 49 284 1.59e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156761
Predicted Effect probably benign
Transcript: ENSMUST00000164056
SMART Domains Protein: ENSMUSP00000132361
Gene: ENSMUSG00000048897

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 106 127 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
ZnF_C2H2 297 319 2.71e-2 SMART
ZnF_C2H2 325 347 1.92e-2 SMART
ZnF_C2H2 353 375 2.71e-2 SMART
ZnF_C2H2 381 403 1.18e-2 SMART
ZnF_C2H2 409 431 1.67e-2 SMART
ZnF_C2H2 437 459 4.87e-4 SMART
ZnF_C2H2 465 487 3.83e-2 SMART
ZnF_C2H2 493 515 2.12e-4 SMART
ZnF_C2H2 521 543 3.63e-3 SMART
ZnF_C2H2 549 571 1.58e-3 SMART
ZnF_C2H2 577 600 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206714
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the mitochondria. It plays a role in intermediary metabolism and energy production. This protein may tightly associate or interact with the pyruvate dehydrogenase complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit suppression of tumorigenesis from B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Idh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Idh2 APN 7 80097945 missense probably benign
IGL02281:Idh2 APN 7 80095802 unclassified probably null
IGL02874:Idh2 APN 7 80097873 missense probably damaging 1.00
IGL02892:Idh2 APN 7 80095670 missense probably benign
IGL02937:Idh2 APN 7 80098913 missense probably damaging 1.00
IGL02989:Idh2 APN 7 80099108 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0040:Idh2 UTSW 7 80097822 missense probably damaging 1.00
R0090:Idh2 UTSW 7 80097914 missense probably damaging 1.00
R0322:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0384:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0385:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0386:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0387:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R0494:Idh2 UTSW 7 80098257 missense probably damaging 1.00
R1603:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1681:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1711:Idh2 UTSW 7 80099158 missense probably damaging 1.00
R1844:Idh2 UTSW 7 80098877 missense probably benign 0.31
R3700:Idh2 UTSW 7 80099147 missense probably damaging 1.00
R4941:Idh2 UTSW 7 80096099 missense probably damaging 0.98
R5234:Idh2 UTSW 7 80096105 missense probably damaging 0.99
R5387:Idh2 UTSW 7 80098331 intron probably benign
R5582:Idh2 UTSW 7 80098339 frame shift probably null
R5655:Idh2 UTSW 7 80098248 missense probably damaging 0.99
R6191:Idh2 UTSW 7 80098331 intron probably benign
R6261:Idh2 UTSW 7 80098329 intron probably benign
R6311:Idh2 UTSW 7 80098331 intron probably benign
R6351:Idh2 UTSW 7 80098331 intron probably benign
R6413:Idh2 UTSW 7 80098331 intron probably benign
R6561:Idh2 UTSW 7 80098331 intron probably benign
R6709:Idh2 UTSW 7 80098331 intron probably benign
R6772:Idh2 UTSW 7 80098331 intron probably benign
R6781:Idh2 UTSW 7 80098331 intron probably benign
R6848:Idh2 UTSW 7 80098331 intron probably benign
R6861:Idh2 UTSW 7 80098218 missense probably damaging 1.00
R6899:Idh2 UTSW 7 80098331 intron probably benign
R7063:Idh2 UTSW 7 80095684 missense probably damaging 1.00
R7076:Idh2 UTSW 7 80098331 intron probably benign
R7081:Idh2 UTSW 7 80098329 intron probably benign
R7090:Idh2 UTSW 7 80098331 intron probably benign
R7254:Idh2 UTSW 7 80098331 frame shift probably null
R7298:Idh2 UTSW 7 80098331 intron probably benign
R7401:Idh2 UTSW 7 80098329 intron probably benign
R7560:Idh2 UTSW 7 80098331 frame shift probably null
R7561:Idh2 UTSW 7 80098331 intron probably benign
R7694:Idh2 UTSW 7 80098331 intron probably benign
R7816:Idh2 UTSW 7 80098331 intron probably benign
R7884:Idh2 UTSW 7 80098329 intron probably benign
R7936:Idh2 UTSW 7 80098331 intron probably benign
R7940:Idh2 UTSW 7 80098331 intron probably benign
R7942:Idh2 UTSW 7 80098331 intron probably benign
R7980:Idh2 UTSW 7 80098329 intron probably benign
R8009:Idh2 UTSW 7 80098253 missense probably benign 0.18
R8036:Idh2 UTSW 7 80098331 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCATCAGAGGTTGTTACTTG -3'
(R):5'- GCTTAAACAAGCCTGTACCAGC -3'

Sequencing Primer
(F):5'- GTCAAAGATCTCCTGGAAGATGTC -3'
(R):5'- GCCTGTACCAGCTATAAGGTCTAG -3'
Posted On2019-12-04