Incidental Mutation 'RF030:Eed'
ID604315
Institutional Source Beutler Lab
Gene Symbol Eed
Ensembl Gene ENSMUSG00000030619
Gene Nameembryonic ectoderm development
Synonymsl7Rn5, l(7)5Rn
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #RF030 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location89954654-89980983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89955032 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 411 (A411S)
Ref Sequence ENSEMBL: ENSMUSP00000102853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107234] [ENSMUST00000207980]
PDB Structure
Structural basis of EZH2 recognition by EED [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000107234
AA Change: A411S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102853
Gene: ENSMUSG00000030619
AA Change: A411S

DomainStartEndE-ValueType
WD40 81 125 1.43e1 SMART
WD40 131 176 2.04e2 SMART
WD40 179 219 1.3e-7 SMART
WD40 222 264 1.61e-3 SMART
WD40 295 332 7.1e1 SMART
Blast:WD40 349 390 1e-17 BLAST
WD40 397 438 4.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207980
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are dwarfed and their coat color is dilute. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Eed
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Eed APN 7 89969595 missense possibly damaging 0.71
IGL02232:Eed APN 7 89972285 missense probably damaging 1.00
IGL02740:Eed APN 7 89972256 missense possibly damaging 0.91
R0417:Eed UTSW 7 89971552 nonsense probably null
R1018:Eed UTSW 7 89967811 splice site probably benign
R1581:Eed UTSW 7 89980468 missense possibly damaging 0.53
R3959:Eed UTSW 7 89954941 missense probably benign 0.10
R4774:Eed UTSW 7 89964768 missense probably damaging 1.00
R5021:Eed UTSW 7 89972305 missense probably damaging 0.98
R5238:Eed UTSW 7 89976965 missense probably benign
R5561:Eed UTSW 7 89967793 missense probably damaging 1.00
R5959:Eed UTSW 7 89969627 missense probably damaging 1.00
R6223:Eed UTSW 7 89956287 missense probably damaging 1.00
R6391:Eed UTSW 7 89976941 missense probably benign 0.00
R6502:Eed UTSW 7 89977029 missense probably benign 0.00
R7021:Eed UTSW 7 89980519 missense possibly damaging 0.53
R7054:Eed UTSW 7 89964727 critical splice donor site probably null
R7056:Eed UTSW 7 89970356 missense possibly damaging 0.54
R7808:Eed UTSW 7 89956333 missense probably benign 0.04
R7836:Eed UTSW 7 89980814 start gained probably benign
R7919:Eed UTSW 7 89980814 start gained probably benign
RF029:Eed UTSW 7 89955032 missense probably benign
Z1177:Eed UTSW 7 89980514 missense probably benign 0.01
Z1177:Eed UTSW 7 89980515 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGCTCTATGTGCCCTTACTAGC -3'
(R):5'- GAAATTTGAGAATGAATCCTTGGGG -3'

Sequencing Primer
(F):5'- TGTGCCCTTACTAGCAAGATAC -3'
(R):5'- TGGCTGTCCTGGAACTCAGAAATC -3'
Posted On2019-12-04