Incidental Mutation 'RF030:Gucy2d'
ID604316
Institutional Source Beutler Lab
Gene Symbol Gucy2d
Ensembl Gene ENSMUSG00000074003
Gene Nameguanylate cyclase 2d
Synonymsguanylyl cyclase D
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #RF030 (G1)
Quality Score150.467
Status Not validated
Chromosome7
Chromosomal Location98440416-98477479 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) C to CTGGGGCCTG at 98459034 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098274] [ENSMUST00000206435]
Predicted Effect probably benign
Transcript: ENSMUST00000098274
SMART Domains Protein: ENSMUSP00000095875
Gene: ENSMUSG00000074003

DomainStartEndE-ValueType
low complexity region 39 65 N/A INTRINSIC
Pfam:ANF_receptor 88 421 6.7e-49 PFAM
transmembrane domain 479 501 N/A INTRINSIC
Pfam:Pkinase_Tyr 562 811 1.4e-33 PFAM
Pfam:Pkinase 575 811 1.3e-28 PFAM
CYCc 850 1045 8.67e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206435
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozugous for a null allele lack olfactory response to uroguanylin and guanylin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Gucy2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Gucy2d APN 7 98449963 missense probably benign 0.03
IGL02093:Gucy2d APN 7 98443548 nonsense probably null
IGL02839:Gucy2d APN 7 98443989 missense possibly damaging 0.81
IGL02904:Gucy2d APN 7 98462189 splice site probably null
IGL03253:Gucy2d APN 7 98451664 missense probably benign 0.03
IGL03349:Gucy2d APN 7 98449841 missense possibly damaging 0.75
R0025:Gucy2d UTSW 7 98467752 missense probably benign
R0362:Gucy2d UTSW 7 98443685 missense probably damaging 1.00
R0379:Gucy2d UTSW 7 98459002 splice site probably null
R0381:Gucy2d UTSW 7 98459002 splice site probably null
R0507:Gucy2d UTSW 7 98459002 splice site probably null
R0890:Gucy2d UTSW 7 98473265 missense probably benign 0.43
R1720:Gucy2d UTSW 7 98477230 missense probably benign 0.28
R1721:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1867:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1868:Gucy2d UTSW 7 98454061 missense probably damaging 0.99
R1884:Gucy2d UTSW 7 98451608 missense probably benign 0.00
R1913:Gucy2d UTSW 7 98443847 missense probably benign 0.14
R2351:Gucy2d UTSW 7 98464019 missense probably benign 0.02
R4683:Gucy2d UTSW 7 98453443 missense probably benign 0.33
R5079:Gucy2d UTSW 7 98458268 critical splice acceptor site probably null
R5285:Gucy2d UTSW 7 98458267 splice site probably null
R5433:Gucy2d UTSW 7 98449775 missense probably damaging 1.00
R5859:Gucy2d UTSW 7 98451883 missense probably benign
R6148:Gucy2d UTSW 7 98443823 missense probably benign
R6468:Gucy2d UTSW 7 98449961 missense probably benign 0.00
R6909:Gucy2d UTSW 7 98467625 missense probably damaging 0.99
R7400:Gucy2d UTSW 7 98443640 missense possibly damaging 0.95
R7483:Gucy2d UTSW 7 98449757 missense probably damaging 1.00
R7707:Gucy2d UTSW 7 98451669 missense possibly damaging 0.75
R7903:Gucy2d UTSW 7 98459065 missense probably damaging 1.00
R7986:Gucy2d UTSW 7 98459065 missense probably damaging 1.00
RF055:Gucy2d UTSW 7 98459041 small insertion probably benign
RF064:Gucy2d UTSW 7 98459043 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCACAGTACCCCACAGTTTCTG -3'
(R):5'- CACCGTTAGGCTTTAGGCATG -3'

Sequencing Primer
(F):5'- ACAGTTTCTGTGTTTGGACCTAGAAC -3'
(R):5'- TTCCTGAAAGTCACAGAACTTCCTAG -3'
Posted On2019-12-04