Incidental Mutation 'RF030:Rfx4'
ID604324
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Synonyms4933412G19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF030 (G1)
Quality Score217.468
Status Not validated
Chromosome10
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) TCTCTCTCTCTCTCT to TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT at 84858480 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000051107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect probably benign
Transcript: ENSMUST00000060397
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095388
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166696
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCTGC 19: 5,425,226 probably benign Het
AI837181 GGC GGCCGC 19: 5,425,235 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,560,913 probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,560,927 probably benign Het
AY761185 GGGCACTGTGG GGG 8: 20,943,900 probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,386,848 probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,502,722 probably benign Het
Cul9 CCTC CCTCCTC 17: 46,500,869 probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,409 probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 87,040,415 probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,767,182 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eed C A 7: 89,955,032 A411S probably benign Het
Fer1l4 GGTC G 2: 156,045,529 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gab3 CTTTT CT X: 74,999,977 probably benign Het
Gab3 TCT TCTGCT X: 75,000,005 probably benign Het
Gab3 TCT TCTCCT X: 75,000,008 probably benign Het
Gab3 TTC TTCGTC X: 75,000,025 probably benign Het
Gab3 TCT TCTGCT X: 75,000,026 probably benign Het
Gm35339 AGGAGGAGG AG 15: 76,363,165 probably null Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,156 probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,671,393 probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,459,034 probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 probably benign Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,125,827 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,586,377 probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 93,018,141 probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 93,018,344 probably benign Het
Lrmp ATTG ATTGAGCACGTTG 6: 145,173,788 probably benign Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,828 probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,306,311 probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,306,317 probably benign Het
Med12l GCA GCATCA 3: 59,275,989 probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,076,111 probably null Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pkhd1l1 TTTTTTT TTTTTTTTTGTTTTTT 15: 44,558,502 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,301 probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,785,311 probably benign Het
Six5 CGGA C 7: 19,094,800 probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,833,568 probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,833,574 probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,835,723 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tfeb GCA GCACCA 17: 47,786,112 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,113 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Thegl AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,016,401 probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,801,325 probably benign Het
Tsen2 GGA GGACGA 6: 115,560,067 probably benign Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,036,483 probably benign Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0503:Rfx4 UTSW 10 84894332 missense possibly damaging 0.56
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1738:Rfx4 UTSW 10 84880975 critical splice donor site probably null
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5156:Rfx4 UTSW 10 84868354 missense probably damaging 1.00
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6358:Rfx4 UTSW 10 84844235 missense probably damaging 1.00
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
R7427:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7428:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7514:Rfx4 UTSW 10 84880226 missense probably damaging 1.00
R7576:Rfx4 UTSW 10 84863349 missense probably damaging 0.98
R8002:Rfx4 UTSW 10 84840857 missense probably damaging 0.97
RF010:Rfx4 UTSW 10 84858487 critical splice acceptor site probably benign
RF014:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF015:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF023:Rfx4 UTSW 10 84858485 critical splice acceptor site probably benign
RF035:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF046:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
RF060:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF062:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Z1177:Rfx4 UTSW 10 84814684 missense possibly damaging 0.85
Z1177:Rfx4 UTSW 10 84896091 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ATTCTGGATGCCACCGTGTTG -3'
(R):5'- GAGTAGCTTTGAACTGTTGCCC -3'

Sequencing Primer
(F):5'- ACCACTGTGCATCATGGACTG -3'
(R):5'- GAACTGTTGCCCTCACTTTCAG -3'
Posted On2019-12-04