Incidental Mutation 'RF030:Pkhd1l1'
ID 604327
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Name polycystic kidney and hepatic disease 1-like 1
Synonyms fibrocystin L, D86 mRNA, PKHDL1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF030 (G1)
Quality Score 212.468
Status Not validated
Chromosome 15
Chromosomal Location 44320890-44464765 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) TTTTTTT to TTTTTTTTTGTTTTTT at 44421898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000038336
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166957
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209244
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.5%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GGC GGCCGC 19: 5,475,263 (GRCm39) probably benign Het
AI837181 GGC GGCTGC 19: 5,475,254 (GRCm39) probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,738,920 (GRCm39) probably benign Het
Ankhd1 GCGGCG GCGGCGCCGGCG 18: 36,693,966 (GRCm39) probably benign Het
Ankhd1 GGCGGCAGC GGCGGCAGCGGCAGC 18: 36,693,980 (GRCm39) probably benign Het
AY761185 GGGCACTGTGG GGG 8: 21,433,916 (GRCm39) probably null Het
B430218F22Rik GG GGTCGGCG 13: 118,523,384 (GRCm39) probably benign Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGATGTGGCTGTGGCTGTGGCTGTGG 19: 47,129,692 (GRCm39) probably benign Het
Cox7a2l GGA GGATAGGGA 17: 83,810,151 (GRCm39) probably benign Het
Cul9 CCTC CCTCCTC 17: 46,811,795 (GRCm39) probably benign Het
Cyb5r4 ACACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACACTGCCCAGGGATGTGACAGCCACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,462 (GRCm39) probably benign Het
Cyb5r4 TGCCCAGGGATGTGACAGACACAC TGCCCAGGGATGTGACAGACACACGGCCCAGGGATGTGACAGACACAC 9: 86,922,468 (GRCm39) probably benign Het
Dmkn GTG GTGTTGGAAGTGGTGGAAGTGGTGGAAATG 7: 30,466,607 (GRCm39) probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Eed C A 7: 89,604,240 (GRCm39) A411S probably benign Het
Fer1l4 GGTC G 2: 155,887,449 (GRCm39) probably benign Het
Frem3 GATC GATCATC 8: 81,341,867 (GRCm39) probably benign Het
Gab3 CTTTT CT X: 74,043,583 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,611 (GRCm39) probably benign Het
Gab3 TCT TCTGCT X: 74,043,632 (GRCm39) probably benign Het
Gab3 TTC TTCGTC X: 74,043,631 (GRCm39) probably benign Het
Gab3 TCT TCTCCT X: 74,043,614 (GRCm39) probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,325,037 (GRCm39) probably null Het
Gm572 TGGGGGGGGGGGG TGGGGG 4: 148,755,850 (GRCm39) probably null Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,646,090 (GRCm39) probably benign Het
Gucy2d C CTGGGGCCTG 7: 98,108,241 (GRCm39) probably benign Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGACACAGCTGCAG 4: 59,610,647 (GRCm39) probably benign Het
Idh2 GGTCCCAG GG 7: 79,748,077 (GRCm39) probably benign Het
Il2 GTGG GTGGGGCTTGAACTGG 3: 37,179,976 (GRCm39) probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,179,991 (GRCm39) probably benign Het
Irag2 ATTG ATTGAGCACGTTG 6: 145,119,514 (GRCm39) probably benign Het
Irag2 TG TGAGCACATGG 6: 145,119,516 (GRCm39) probably benign Het
Kmt2b CTCCTC CTCCTCTTCCTC 7: 30,285,802 (GRCm39) probably benign Het
Lce1m GCTGCCAC GCTGCCACAGCAACTTCTGCCAC 3: 92,925,651 (GRCm39) probably benign Het
Lce1m C CGGCTGCTGCCAA 3: 92,925,448 (GRCm39) probably benign Het
Mamld1 CAG CAGTAG X: 70,162,434 (GRCm39) probably null Het
Map1a CAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCTAGCTCCA 2: 121,136,792 (GRCm39) probably benign Het
Map1a CA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCAA 2: 121,136,798 (GRCm39) probably benign Het
Med12l GCA GCATCA 3: 59,183,410 (GRCm39) probably benign Het
Morn4 GCAGTGAG GCAGTGAGTCAGTCAGTGAG 19: 42,064,550 (GRCm39) probably null Het
Pdik1l C CCACCAA 4: 134,006,827 (GRCm39) probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCCCTCTCTCTCTCTCT 10: 84,694,344 (GRCm39) probably benign Het
Setd1a GGTGGTAGT GGTGGTAGTTGTGGTAGT 7: 127,384,483 (GRCm39) probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,384,473 (GRCm39) probably benign Het
Six5 CGGA C 7: 18,828,725 (GRCm39) probably benign Het
Spmap2l AGCGATCCTCCCCAGTCCCGCAAGGCC AGCGATCCTCCCCTGTCCCGCAAGGCCGGCGATCCTCCCCAGTCCCGCAAGGCC 5: 77,164,248 (GRCm39) probably benign Het
Tcof1 CTGCTGCTGC CTGCTGCTGCTGC 18: 60,968,795 (GRCm39) probably benign Het
Tcof1 CCAGA CCAGACATCCCCTTGGCTGCTGAGCTGGGCACTTTCTCAGA 18: 60,966,640 (GRCm39) probably benign Het
Tcof1 ATCCCCTTGGC ATCCCCTTGGCTGCTGAGATGGGCACTTTCCCAGAGGTCCCCTTGGC 18: 60,966,646 (GRCm39) probably benign Het
Tfeb GCA GCACCA 17: 48,097,037 (GRCm39) probably benign Het
Tfeb AGC AGCCGC 17: 48,097,036 (GRCm39) probably benign Het
Tfeb CAG CAGAAG 17: 48,097,038 (GRCm39) probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,593,019 (GRCm39) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,593,046 (GRCm39) probably benign Het
Tomm5 GCATCTTCC GCATCTTCCACATCTTCC 4: 45,107,973 (GRCm39) probably benign Het
Trappc9 TGCTGCT TGCTGCTGCTGCTGCGGCTGCT 15: 72,673,174 (GRCm39) probably benign Het
Tsen2 GGA GGACGA 6: 115,537,028 (GRCm39) probably benign Het
Wdr97 AGGAGGAGG AG 15: 76,247,365 (GRCm39) probably null Het
Zfp384 GCCCAGGCCCAG GCCCAGGCCCAGTCCCAGGCCCAG 6: 125,013,446 (GRCm39) probably benign Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44,340,982 (GRCm39) missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44,419,415 (GRCm39) missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44,354,425 (GRCm39) missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44,455,388 (GRCm39) missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44,363,443 (GRCm39) missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44,449,870 (GRCm39) missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44,426,148 (GRCm39) splice site probably null
IGL01089:Pkhd1l1 APN 15 44,347,265 (GRCm39) splice site probably benign
IGL01094:Pkhd1l1 APN 15 44,410,325 (GRCm39) missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44,368,708 (GRCm39) critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44,393,425 (GRCm39) missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44,396,378 (GRCm39) missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44,347,229 (GRCm39) nonsense probably null
IGL01546:Pkhd1l1 APN 15 44,429,712 (GRCm39) missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44,392,806 (GRCm39) missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44,392,747 (GRCm39) missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44,362,796 (GRCm39) splice site probably benign
IGL02007:Pkhd1l1 APN 15 44,397,129 (GRCm39) splice site probably benign
IGL02041:Pkhd1l1 APN 15 44,356,452 (GRCm39) splice site probably null
IGL02171:Pkhd1l1 APN 15 44,379,542 (GRCm39) missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44,376,245 (GRCm39) missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44,437,010 (GRCm39) missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44,322,822 (GRCm39) missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44,421,993 (GRCm39) missense probably benign
IGL02522:Pkhd1l1 APN 15 44,419,298 (GRCm39) missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44,441,896 (GRCm39) missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44,389,450 (GRCm39) splice site probably null
IGL02602:Pkhd1l1 APN 15 44,421,327 (GRCm39) missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44,452,852 (GRCm39) missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44,448,269 (GRCm39) missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44,403,063 (GRCm39) missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44,427,720 (GRCm39) missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44,347,210 (GRCm39) missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44,393,441 (GRCm39) critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44,379,605 (GRCm39) critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44,404,346 (GRCm39) missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44,364,889 (GRCm39) missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44,392,939 (GRCm39) missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44,364,927 (GRCm39) missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44,376,304 (GRCm39) missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44,421,400 (GRCm39) missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44,460,298 (GRCm39) missense probably benign 0.41
IGL03030:Pkhd1l1 APN 15 44,455,372 (GRCm39) missense probably benign 0.00
IGL03132:Pkhd1l1 APN 15 44,438,013 (GRCm39) missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44,381,531 (GRCm39) missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44,460,291 (GRCm39) missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44,445,222 (GRCm39) missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44,402,348 (GRCm39) missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44,457,980 (GRCm39) missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44,410,914 (GRCm39) splice site probably benign
IGL03377:Pkhd1l1 APN 15 44,347,747 (GRCm39) splice site probably null
R0310_Pkhd1l1_251 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344_Pkhd1l1_462 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R1737_Pkhd1l1_815 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R5049_Pkhd1l1_556 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
K7371:Pkhd1l1 UTSW 15 44,363,463 (GRCm39) missense possibly damaging 0.94
K7371:Pkhd1l1 UTSW 15 44,400,838 (GRCm39) missense possibly damaging 0.67
N/A - 287:Pkhd1l1 UTSW 15 44,445,654 (GRCm39) missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44,391,643 (GRCm39) missense probably damaging 1.00
P4717OSA:Pkhd1l1 UTSW 15 44,386,895 (GRCm39) missense probably benign 0.17
R0007:Pkhd1l1 UTSW 15 44,437,794 (GRCm39) splice site probably benign
R0020:Pkhd1l1 UTSW 15 44,420,268 (GRCm39) missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44,367,405 (GRCm39) missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44,437,021 (GRCm39) missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44,437,203 (GRCm39) missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44,392,633 (GRCm39) missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44,419,404 (GRCm39) missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0103:Pkhd1l1 UTSW 15 44,460,537 (GRCm39) missense probably benign
R0127:Pkhd1l1 UTSW 15 44,418,001 (GRCm39) missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44,390,180 (GRCm39) missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44,423,831 (GRCm39) missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44,386,134 (GRCm39) splice site probably benign
R0344:Pkhd1l1 UTSW 15 44,460,407 (GRCm39) missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44,364,915 (GRCm39) missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44,383,086 (GRCm39) missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44,452,814 (GRCm39) missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44,390,150 (GRCm39) missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44,386,887 (GRCm39) critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44,352,942 (GRCm39) missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44,347,820 (GRCm39) missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44,330,820 (GRCm39) missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44,347,234 (GRCm39) missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44,399,184 (GRCm39) missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44,392,660 (GRCm39) missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44,358,993 (GRCm39) missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44,402,279 (GRCm39) splice site probably null
R0942:Pkhd1l1 UTSW 15 44,396,355 (GRCm39) missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44,455,360 (GRCm39) missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44,400,837 (GRCm39) missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44,361,447 (GRCm39) missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44,361,392 (GRCm39) missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44,452,993 (GRCm39) missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44,368,943 (GRCm39) missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44,404,384 (GRCm39) splice site probably benign
R1445:Pkhd1l1 UTSW 15 44,369,040 (GRCm39) missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44,379,511 (GRCm39) missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44,400,282 (GRCm39) missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44,408,890 (GRCm39) missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44,390,120 (GRCm39) missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44,408,897 (GRCm39) splice site probably null
R1571:Pkhd1l1 UTSW 15 44,390,237 (GRCm39) missense probably benign
R1572:Pkhd1l1 UTSW 15 44,406,869 (GRCm39) missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44,330,763 (GRCm39) nonsense probably null
R1638:Pkhd1l1 UTSW 15 44,460,513 (GRCm39) missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44,404,351 (GRCm39) missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44,410,905 (GRCm39) critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44,391,635 (GRCm39) missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44,366,741 (GRCm39) missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44,388,638 (GRCm39) missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44,366,733 (GRCm39) missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44,404,280 (GRCm39) missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44,363,434 (GRCm39) missense probably benign
R1975:Pkhd1l1 UTSW 15 44,393,109 (GRCm39) missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2037:Pkhd1l1 UTSW 15 44,431,617 (GRCm39) splice site probably null
R2045:Pkhd1l1 UTSW 15 44,343,050 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,445,137 (GRCm39) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,410,909 (GRCm39) splice site probably benign
R2063:Pkhd1l1 UTSW 15 44,414,148 (GRCm39) missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44,422,035 (GRCm39) missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44,391,163 (GRCm39) missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44,432,878 (GRCm39) missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44,379,581 (GRCm39) missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44,364,853 (GRCm39) missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44,393,214 (GRCm39) missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44,376,273 (GRCm39) splice site probably null
R2150:Pkhd1l1 UTSW 15 44,363,378 (GRCm39) splice site probably null
R2177:Pkhd1l1 UTSW 15 44,322,791 (GRCm39) missense probably benign
R2184:Pkhd1l1 UTSW 15 44,362,692 (GRCm39) missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44,437,291 (GRCm39) missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44,376,188 (GRCm39) missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44,410,323 (GRCm39) missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44,391,646 (GRCm39) missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44,343,003 (GRCm39) missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44,423,902 (GRCm39) missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44,396,415 (GRCm39) missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44,391,574 (GRCm39) missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44,414,216 (GRCm39) missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44,348,824 (GRCm39) missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44,408,782 (GRCm39) missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44,404,267 (GRCm39) missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44,410,644 (GRCm39) missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44,408,766 (GRCm39) missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44,368,924 (GRCm39) missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44,410,760 (GRCm39) missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44,390,265 (GRCm39) missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44,409,983 (GRCm39) missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44,452,802 (GRCm39) missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44,378,371 (GRCm39) critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44,356,531 (GRCm39) missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44,455,422 (GRCm39) critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44,392,496 (GRCm39) missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44,361,953 (GRCm39) missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44,414,156 (GRCm39) missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44,387,045 (GRCm39) missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44,455,302 (GRCm39) missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44,368,949 (GRCm39) missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44,445,200 (GRCm39) missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44,414,281 (GRCm39) missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44,403,078 (GRCm39) missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44,347,796 (GRCm39) missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44,410,743 (GRCm39) missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44,419,428 (GRCm39) missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44,361,417 (GRCm39) missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44,392,801 (GRCm39) missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44,354,497 (GRCm39) missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44,400,774 (GRCm39) missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44,397,287 (GRCm39) missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44,367,421 (GRCm39) missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44,391,587 (GRCm39) missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44,445,623 (GRCm39) missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44,431,720 (GRCm39) missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44,321,012 (GRCm39) missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44,445,689 (GRCm39) missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44,455,283 (GRCm39) missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44,368,705 (GRCm39) missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44,410,544 (GRCm39) missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44,410,437 (GRCm39) missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44,359,043 (GRCm39) nonsense probably null
R5286:Pkhd1l1 UTSW 15 44,378,368 (GRCm39) nonsense probably null
R5292:Pkhd1l1 UTSW 15 44,392,962 (GRCm39) missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44,399,146 (GRCm39) missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44,367,442 (GRCm39) missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44,410,258 (GRCm39) missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44,404,363 (GRCm39) missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44,422,042 (GRCm39) missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44,396,388 (GRCm39) missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44,408,813 (GRCm39) missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44,383,103 (GRCm39) missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44,429,718 (GRCm39) missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44,445,186 (GRCm39) missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44,441,984 (GRCm39) missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44,390,159 (GRCm39) missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44,396,361 (GRCm39) missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44,322,859 (GRCm39) missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44,408,812 (GRCm39) missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44,389,384 (GRCm39) missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44,352,900 (GRCm39) splice site probably null
R6066:Pkhd1l1 UTSW 15 44,391,525 (GRCm39) missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44,392,955 (GRCm39) missense probably benign
R6294:Pkhd1l1 UTSW 15 44,433,424 (GRCm39) missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44,452,921 (GRCm39) missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44,361,485 (GRCm39) critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44,392,539 (GRCm39) missense probably benign
R6736:Pkhd1l1 UTSW 15 44,421,336 (GRCm39) missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44,453,059 (GRCm39) missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44,426,051 (GRCm39) missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44,452,923 (GRCm39) missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44,386,025 (GRCm39) missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44,375,070 (GRCm39) missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44,429,664 (GRCm39) missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44,437,027 (GRCm39) missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44,421,372 (GRCm39) missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44,448,374 (GRCm39) critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44,437,033 (GRCm39) missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44,330,800 (GRCm39) missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44,392,512 (GRCm39) missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44,386,949 (GRCm39) missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44,391,559 (GRCm39) missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44,386,091 (GRCm39) missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44,410,337 (GRCm39) missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44,366,676 (GRCm39) missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44,361,986 (GRCm39) missense probably benign
R7304:Pkhd1l1 UTSW 15 44,361,878 (GRCm39) missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44,378,350 (GRCm39) missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44,452,882 (GRCm39) missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44,458,407 (GRCm39) missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44,368,581 (GRCm39) nonsense probably null
R7481:Pkhd1l1 UTSW 15 44,376,307 (GRCm39) missense probably benign
R7554:Pkhd1l1 UTSW 15 44,358,866 (GRCm39) missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44,414,157 (GRCm39) missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44,378,326 (GRCm39) missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44,431,760 (GRCm39) critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44,358,917 (GRCm39) missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44,391,133 (GRCm39) missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44,449,804 (GRCm39) missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44,393,280 (GRCm39) missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44,404,303 (GRCm39) missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44,406,965 (GRCm39) missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44,441,977 (GRCm39) missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44,460,534 (GRCm39) nonsense probably null
R7864:Pkhd1l1 UTSW 15 44,389,449 (GRCm39) critical splice donor site probably null
R7883:Pkhd1l1 UTSW 15 44,392,522 (GRCm39) missense probably damaging 1.00
R8031:Pkhd1l1 UTSW 15 44,376,230 (GRCm39) missense probably damaging 1.00
R8128:Pkhd1l1 UTSW 15 44,361,449 (GRCm39) missense possibly damaging 0.94
R8142:Pkhd1l1 UTSW 15 44,378,327 (GRCm39) missense probably benign 0.00
R8150:Pkhd1l1 UTSW 15 44,410,055 (GRCm39) missense possibly damaging 0.68
R8209:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8212:Pkhd1l1 UTSW 15 44,362,696 (GRCm39) missense probably benign 0.12
R8226:Pkhd1l1 UTSW 15 44,437,803 (GRCm39) missense possibly damaging 0.46
R8248:Pkhd1l1 UTSW 15 44,406,942 (GRCm39) missense probably damaging 0.99
R8299:Pkhd1l1 UTSW 15 44,445,330 (GRCm39) missense probably benign 0.26
R8425:Pkhd1l1 UTSW 15 44,437,911 (GRCm39) missense probably benign 0.01
R8485:Pkhd1l1 UTSW 15 44,423,796 (GRCm39) missense probably damaging 0.98
R8486:Pkhd1l1 UTSW 15 44,410,812 (GRCm39) missense probably damaging 1.00
R8701:Pkhd1l1 UTSW 15 44,438,079 (GRCm39) missense probably damaging 1.00
R8709:Pkhd1l1 UTSW 15 44,381,570 (GRCm39) missense probably benign 0.01
R8777:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Pkhd1l1 UTSW 15 44,361,967 (GRCm39) missense probably damaging 1.00
R8845:Pkhd1l1 UTSW 15 44,368,650 (GRCm39) missense probably benign 0.30
R8846:Pkhd1l1 UTSW 15 44,410,358 (GRCm39) nonsense probably null
R8863:Pkhd1l1 UTSW 15 44,433,382 (GRCm39) nonsense probably null
R8917:Pkhd1l1 UTSW 15 44,396,403 (GRCm39) missense probably benign 0.04
R8936:Pkhd1l1 UTSW 15 44,402,312 (GRCm39) missense possibly damaging 0.94
R8962:Pkhd1l1 UTSW 15 44,400,291 (GRCm39) missense probably damaging 1.00
R8971:Pkhd1l1 UTSW 15 44,392,915 (GRCm39) missense possibly damaging 0.68
R8973:Pkhd1l1 UTSW 15 44,449,833 (GRCm39) missense probably damaging 1.00
R8982:Pkhd1l1 UTSW 15 44,387,069 (GRCm39) nonsense probably null
R8994:Pkhd1l1 UTSW 15 44,410,499 (GRCm39) missense probably damaging 0.99
R9004:Pkhd1l1 UTSW 15 44,406,768 (GRCm39) missense probably benign 0.16
R9064:Pkhd1l1 UTSW 15 44,426,038 (GRCm39) missense possibly damaging 0.93
R9173:Pkhd1l1 UTSW 15 44,384,152 (GRCm39) missense probably benign 0.09
R9185:Pkhd1l1 UTSW 15 44,453,019 (GRCm39) missense probably benign 0.01
R9213:Pkhd1l1 UTSW 15 44,358,874 (GRCm39) missense probably damaging 1.00
R9218:Pkhd1l1 UTSW 15 44,384,122 (GRCm39) missense possibly damaging 0.90
R9256:Pkhd1l1 UTSW 15 44,397,290 (GRCm39) critical splice donor site probably null
R9291:Pkhd1l1 UTSW 15 44,433,372 (GRCm39) missense probably damaging 1.00
R9309:Pkhd1l1 UTSW 15 44,400,289 (GRCm39) missense probably benign 0.00
R9319:Pkhd1l1 UTSW 15 44,392,974 (GRCm39) missense possibly damaging 0.46
R9339:Pkhd1l1 UTSW 15 44,452,949 (GRCm39) missense probably damaging 1.00
R9366:Pkhd1l1 UTSW 15 44,410,308 (GRCm39) missense probably benign 0.03
R9444:Pkhd1l1 UTSW 15 44,418,053 (GRCm39) missense probably benign 0.00
R9464:Pkhd1l1 UTSW 15 44,343,009 (GRCm39) missense probably damaging 1.00
R9525:Pkhd1l1 UTSW 15 44,448,322 (GRCm39) missense possibly damaging 0.88
R9542:Pkhd1l1 UTSW 15 44,410,284 (GRCm39) missense probably benign 0.12
R9544:Pkhd1l1 UTSW 15 44,410,239 (GRCm39) missense probably damaging 1.00
R9608:Pkhd1l1 UTSW 15 44,442,029 (GRCm39) missense possibly damaging 0.65
R9673:Pkhd1l1 UTSW 15 44,386,901 (GRCm39) missense probably benign 0.22
R9771:Pkhd1l1 UTSW 15 44,358,883 (GRCm39) missense probably benign
R9792:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9793:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
R9795:Pkhd1l1 UTSW 15 44,406,983 (GRCm39) missense probably benign 0.00
RF006:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF006:Pkhd1l1 UTSW 15 44,366,634 (GRCm39) missense probably benign 0.03
RF008:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44,421,901 (GRCm39) critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44,421,903 (GRCm39) critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44,421,902 (GRCm39) critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44,421,899 (GRCm39) critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44,421,891 (GRCm39) critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44,455,362 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,441,974 (GRCm39) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,436,972 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCTGGTTATGAAACAATCTTCCAG -3'
(R):5'- AAGATCTCACTCTTACCTGTACTG -3'

Sequencing Primer
(F):5'- CACAGGAGTACAAGGTCAATTTC -3'
(R):5'- CACTCTTACCTGTACTGATATGTAGG -3'
Posted On 2019-12-04