Incidental Mutation 'RF031:Elovl5'
ID604371
Institutional Source Beutler Lab
Gene Symbol Elovl5
Ensembl Gene ENSMUSG00000032349
Gene NameELOVL family member 5, elongation of long chain fatty acids (yeast)
Synonyms1110059L23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF031 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location77917364-77984519 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to T at 77981473 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034904] [ENSMUST00000034904] [ENSMUST00000133757]
Predicted Effect probably null
Transcript: ENSMUST00000034904
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000034904
SMART Domains Protein: ENSMUSP00000034904
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 262 2.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133757
SMART Domains Protein: ENSMUSP00000123121
Gene: ENSMUSG00000032349

DomainStartEndE-ValueType
Pfam:ELO 27 180 4.6e-46 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele have defects in fatty acid synthesis in the liver that result in hepatic steatosis. Also, majority of female mice have defects in female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,490,234 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,216,239 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,907,463 probably benign Het
Other mutations in Elovl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Elovl5 APN 9 77960974 missense probably benign 0.12
IGL01017:Elovl5 APN 9 77981571 missense possibly damaging 0.67
IGL02331:Elovl5 APN 9 77979899 missense possibly damaging 0.81
IGL02851:Elovl5 APN 9 77981502 missense probably damaging 1.00
IGL03011:Elovl5 APN 9 77982784 missense probably benign 0.32
euge UTSW 9 77979823 critical splice acceptor site probably null
laid-up UTSW 9 77981502 missense probably damaging 0.99
R0452:Elovl5 UTSW 9 77960911 missense probably damaging 1.00
R0494:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R3706:Elovl5 UTSW 9 77979837 missense probably null 1.00
R4353:Elovl5 UTSW 9 77960917 missense probably benign 0.05
R6211:Elovl5 UTSW 9 77981502 missense probably damaging 0.99
R6640:Elovl5 UTSW 9 77979913 nonsense probably null
R7804:Elovl5 UTSW 9 77979823 critical splice acceptor site probably null
R8179:Elovl5 UTSW 9 77976899 missense probably damaging 1.00
Z1176:Elovl5 UTSW 9 77976755 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CGTCACTGGCCCCTTTAAAC -3'
(R):5'- TTTCAAAGCACAGTGCCAGC -3'

Sequencing Primer
(F):5'- GTCACTGGCCCCTTTAAACAAGTAC -3'
(R):5'- CCCCACTGAGTGAAAGGACG -3'
Posted On2019-12-04