Incidental Mutation 'RF031:Fgd6'
ID604374
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene NameFYVE, RhoGEF and PH domain containing 6
SynonymsEtohd4, ZFYVE24
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.500) question?
Stock #RF031 (G1)
Quality Score157.457
Status Not validated
Chromosome10
Chromosomal Location94036001-94145339 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ATT to A at 94044325 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
PDB Structure
Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000020208
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Elovl5 G T 9: 77,981,473 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,490,234 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,216,239 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,907,463 probably benign Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 94043634 missense probably benign 0.01
IGL00975:Fgd6 APN 10 94134076 missense probably damaging 0.98
IGL01366:Fgd6 APN 10 94043476 missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 94089650 splice site probably null
IGL01958:Fgd6 APN 10 94138308 missense probably benign 0.25
IGL01988:Fgd6 APN 10 94074335 splice site probably benign
IGL02019:Fgd6 APN 10 94133354 missense probably damaging 1.00
IGL02074:Fgd6 APN 10 94127435 missense probably damaging 1.00
IGL02227:Fgd6 APN 10 94134084 missense probably damaging 1.00
IGL02262:Fgd6 APN 10 94125628 missense probably damaging 0.98
IGL02353:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 94138396 missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 94074202 missense probably benign 0.00
IGL02526:Fgd6 APN 10 94100511 missense probably benign 0.21
IGL02607:Fgd6 APN 10 94044448 missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 94123290 missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 94045164 missense probably damaging 1.00
IGL02884:Fgd6 APN 10 94045639 splice site probably benign
IGL02995:Fgd6 APN 10 94045480 nonsense probably null
IGL03189:Fgd6 APN 10 94044456 missense probably benign 0.26
IGL03258:Fgd6 APN 10 94133353 missense probably benign 0.44
IGL03396:Fgd6 APN 10 94044456 missense probably benign 0.26
FR4449:Fgd6 UTSW 10 94044320 small deletion probably benign
R0257:Fgd6 UTSW 10 94043915 missense probably benign 0.11
R0926:Fgd6 UTSW 10 94135047 missense probably benign 0.40
R1325:Fgd6 UTSW 10 94127427 missense probably damaging 1.00
R1422:Fgd6 UTSW 10 94045372 missense probably damaging 1.00
R1491:Fgd6 UTSW 10 94044832 missense probably benign 0.06
R1593:Fgd6 UTSW 10 94045032 missense probably damaging 1.00
R1624:Fgd6 UTSW 10 94137436 missense probably benign 0.19
R1929:Fgd6 UTSW 10 94045006 missense probably benign 0.01
R2064:Fgd6 UTSW 10 94045041 missense probably damaging 0.98
R2965:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R2966:Fgd6 UTSW 10 94044194 missense probably benign 0.03
R3889:Fgd6 UTSW 10 94089637 missense probably damaging 1.00
R4094:Fgd6 UTSW 10 94043434 missense probably damaging 1.00
R4605:Fgd6 UTSW 10 94044355 missense probably benign 0.12
R4883:Fgd6 UTSW 10 94139853 missense probably benign 0.00
R5217:Fgd6 UTSW 10 94134077 missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 94044676 missense probably benign 0.00
R5606:Fgd6 UTSW 10 94138328 nonsense probably null
R5644:Fgd6 UTSW 10 94134050 missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 94137565 critical splice donor site probably null
R6258:Fgd6 UTSW 10 94044299 missense probably benign 0.00
R6735:Fgd6 UTSW 10 94074320 missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 94043511 missense probably benign 0.02
R7210:Fgd6 UTSW 10 94134092 missense probably damaging 0.98
R7296:Fgd6 UTSW 10 94044047 nonsense probably null
R7296:Fgd6 UTSW 10 94139881 missense probably benign 0.02
R7697:Fgd6 UTSW 10 94045444 missense probably damaging 0.99
R7747:Fgd6 UTSW 10 94044916 missense probably damaging 1.00
R7861:Fgd6 UTSW 10 94103331 missense probably benign 0.15
R7940:Fgd6 UTSW 10 94120482 missense probably benign 0.02
R8022:Fgd6 UTSW 10 94044344 missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 94134143 missense probably null 0.45
R8171:Fgd6 UTSW 10 94074332 critical splice donor site probably null
R8189:Fgd6 UTSW 10 94074215 missense probably benign 0.00
R8213:Fgd6 UTSW 10 94044052 missense probably benign 0.37
RF040:Fgd6 UTSW 10 94044325 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGGTCAAAGGTCTCGG -3'
(R):5'- AACCACTGCTGTCAGAAGTC -3'

Sequencing Primer
(F):5'- AAGGTCTCGGTCCTTTAGAAATCCAC -3'
(R):5'- ACTGCTGTCAGAAGTCAAACTAG -3'
Posted On2019-12-04