Incidental Mutation 'RF031:Nf2'
ID604375
Institutional Source Beutler Lab
Gene Symbol Nf2
Ensembl Gene ENSMUSG00000009073
Gene Nameneurofibromin 2
Synonymsmoesin-ezrin-radixin-like protein, merlin, schwannomin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF031 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location4765845-4849536 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAAAG to A at 4829936 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053079] [ENSMUST00000056290] [ENSMUST00000109910] [ENSMUST00000164190] [ENSMUST00000172305]
Predicted Effect probably benign
Transcript: ENSMUST00000053079
SMART Domains Protein: ENSMUSP00000055033
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056290
SMART Domains Protein: ENSMUSP00000055061
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109910
SMART Domains Protein: ENSMUSP00000105536
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 596 5.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164190
SMART Domains Protein: ENSMUSP00000129388
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 181 1.24e-45 SMART
FERM_C 160 229 1.23e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172305
SMART Domains Protein: ENSMUSP00000130263
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
PDB:1H4R|B 1 38 2e-18 PDB
Blast:B41 1 39 1e-18 BLAST
SCOP:d1h4ra3 20 42 2e-4 SMART
low complexity region 86 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants lack extraembryonic ectoderm, do not initiate gastrulation and die by embryonic day 7. Heterozygotes develop malignant tumors, especially osteosarcomas. Conditional Schwann cell knockouts resemble neurofibromatosis type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Elovl5 G T 9: 77,981,473 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,490,234 probably benign Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,216,239 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,907,463 probably benign Het
Other mutations in Nf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Nf2 APN 11 4791123 missense probably benign 0.00
IGL01072:Nf2 APN 11 4789713 missense probably null 0.00
IGL01349:Nf2 APN 11 4784472 missense possibly damaging 0.94
IGL01686:Nf2 APN 11 4818613 missense probably benign
IGL01820:Nf2 APN 11 4789655 splice site probably null
IGL02251:Nf2 APN 11 4848873 missense probably null 1.00
IGL02755:Nf2 APN 11 4818542 missense probably damaging 1.00
IGL02859:Nf2 APN 11 4791209 missense probably damaging 1.00
R0331:Nf2 UTSW 11 4794914 missense probably benign 0.21
R0513:Nf2 UTSW 11 4791185 missense possibly damaging 0.56
R0606:Nf2 UTSW 11 4782194 missense possibly damaging 0.90
R0734:Nf2 UTSW 11 4820409 missense probably benign 0.00
R1749:Nf2 UTSW 11 4803694 missense possibly damaging 0.60
R2192:Nf2 UTSW 11 4799899 missense probably damaging 1.00
R4073:Nf2 UTSW 11 4848958 missense probably benign 0.27
R4355:Nf2 UTSW 11 4780613 nonsense probably null
R4629:Nf2 UTSW 11 4848915 missense probably damaging 0.99
R5129:Nf2 UTSW 11 4816145 missense probably benign
R5130:Nf2 UTSW 11 4829862 intron probably benign
R5580:Nf2 UTSW 11 4803689 missense probably damaging 1.00
R5599:Nf2 UTSW 11 4782269 missense probably damaging 1.00
R5840:Nf2 UTSW 11 4816146 missense probably benign 0.24
R6017:Nf2 UTSW 11 4816137 missense possibly damaging 0.95
R6029:Nf2 UTSW 11 4784566 splice site probably null
R6230:Nf2 UTSW 11 4808262 missense possibly damaging 0.81
R6897:Nf2 UTSW 11 4799878 missense probably damaging 1.00
R6990:Nf2 UTSW 11 4799944 missense probably benign 0.09
R7155:Nf2 UTSW 11 4799964 missense probably damaging 0.96
R7826:Nf2 UTSW 11 4789750 missense probably benign 0.35
R8427:Nf2 UTSW 11 4791118 missense probably benign 0.00
R8717:Nf2 UTSW 11 4816099 missense probably damaging 1.00
RF028:Nf2 UTSW 11 4829936 frame shift probably null
RF032:Nf2 UTSW 11 4829936 frame shift probably null
RF033:Nf2 UTSW 11 4829936 frame shift probably null
RF041:Nf2 UTSW 11 4829936 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAGTAATCTTACCAGCCCTG -3'
(R):5'- CATCACACTGCAGCCTGTTA -3'

Sequencing Primer
(F):5'- CTGTTCCTAGTCAAGTCAAGGAGC -3'
(R):5'- CTGCAGCCTGTTAATGGAAC -3'
Posted On2019-12-04