Incidental Mutation 'RF031:Nlrp3'
ID 604376
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # RF031 (G1)
Quality Score 201.916
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GGGTA to G at 59449378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148]
AlphaFold Q8R4B8
Predicted Effect probably null
Transcript: ENSMUST00000079476
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000101148
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,475,246 (GRCm39) probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,162,671 (GRCm39) probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,162,654 (GRCm39) probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 86,922,498 (GRCm39) probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,503,444 (GRCm39) probably benign Het
Dclre1a CTTTGCT C 19: 56,532,564 (GRCm39) probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,572,236 (GRCm39) probably null Het
Elovl5 G T 9: 77,888,755 (GRCm39) probably null Het
Ermn AACT AACTACT 2: 57,938,078 (GRCm39) probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,526,017 (GRCm39) probably benign Het
Fgd6 ATT A 10: 93,880,187 (GRCm39) probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,981,132 (GRCm39) probably null Het
Gab3 CTT CTTATT X: 74,043,603 (GRCm39) probably null Het
Gab3 TCT TCTGCT X: 74,043,602 (GRCm39) probably benign Het
Gab3 TTC TTCATC X: 74,043,607 (GRCm39) probably benign Het
Gm11060 CTGTGTG CTG 2: 104,922,385 (GRCm39) probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,325,029 (GRCm39) probably null Het
Heatr3 TAT TATTAAT 8: 88,883,085 (GRCm39) probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,447,814 (GRCm39) probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,479,625 (GRCm39) probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,089,662 (GRCm39) probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,625,026 (GRCm39) probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 95,960,504 (GRCm39) probably null Het
Loricrin ATAGCCG A 3: 91,989,183 (GRCm39) probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,381,060 (GRCm39) probably benign Het
Nf2 AAAAG A 11: 4,779,936 (GRCm39) probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,069,810 (GRCm39) probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,006,685 (GRCm39) probably null Het
Phldb3 CGCCCCCG C 7: 24,325,918 (GRCm39) probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,384,483 (GRCm39) probably benign Het
Spmap2l CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,164,257 (GRCm39) probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,984,706 (GRCm39) probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,966,637 (GRCm39) probably benign Het
Tcof1 AGC AGCGGC 18: 60,968,817 (GRCm39) probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,435,213 (GRCm39) probably benign Het
Tmem59 T TGTTTGTTG 4: 107,047,729 (GRCm39) probably benign Het
Zfhx3 C CCGCAGCAAA 8: 109,682,730 (GRCm39) probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,749,383 (GRCm39) probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCAGGTACAGGTCTCCTAG -3'
(R):5'- ACAGAATCCTAGCTGTGTGCC -3'

Sequencing Primer
(F):5'- AGAGATGGCACTGACCTTGTTCC -3'
(R):5'- AATCCTAGCTGTGTGCCTCATGAAG -3'
Posted On 2019-12-04