Incidental Mutation 'RF031:Mapk7'
ID604377
Institutional Source Beutler Lab
Gene Symbol Mapk7
Ensembl Gene ENSMUSG00000001034
Gene Namemitogen-activated protein kinase 7
Synonymsbig MAP kinase 1, Erk5-T, BMK1, ERK5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF031 (G1)
Quality Score111.467
Status Not validated
Chromosome11
Chromosomal Location61488812-61494406 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GGGGCA to GGGGCACGGGCA at 61490234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064783
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079080
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101085
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108714
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to multiple developmental anomalies and vascular remodelling, cardiac development, and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Elovl5 G T 9: 77,981,473 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,216,239 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,907,463 probably benign Het
Other mutations in Mapk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mapk7 APN 11 61491160 missense probably damaging 1.00
IGL02289:Mapk7 APN 11 61489959 unclassified probably null
IGL03108:Mapk7 APN 11 61491672 missense probably damaging 1.00
IGL03342:Mapk7 APN 11 61491390 missense probably damaging 1.00
FR4340:Mapk7 UTSW 11 61490206 intron probably benign
FR4589:Mapk7 UTSW 11 61490222 intron probably benign
R1497:Mapk7 UTSW 11 61493863 missense possibly damaging 0.53
R1866:Mapk7 UTSW 11 61489413 missense probably benign 0.27
R2870:Mapk7 UTSW 11 61490212 intron probably benign
R2871:Mapk7 UTSW 11 61490212 intron probably benign
R2872:Mapk7 UTSW 11 61490212 intron probably benign
R3831:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3832:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3833:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R4378:Mapk7 UTSW 11 61493667 missense probably damaging 1.00
R4428:Mapk7 UTSW 11 61489229 missense possibly damaging 0.90
R4642:Mapk7 UTSW 11 61490901 missense probably damaging 0.99
R4692:Mapk7 UTSW 11 61489242 missense possibly damaging 0.73
R4718:Mapk7 UTSW 11 61489254 missense possibly damaging 0.73
R4755:Mapk7 UTSW 11 61490843 missense probably damaging 1.00
R4916:Mapk7 UTSW 11 61493649 missense probably damaging 0.97
R4933:Mapk7 UTSW 11 61493908 unclassified probably benign
R5825:Mapk7 UTSW 11 61490381 missense possibly damaging 0.66
R5875:Mapk7 UTSW 11 61493698 missense probably benign 0.13
R5910:Mapk7 UTSW 11 61493621 start codon destroyed probably benign 0.01
R7201:Mapk7 UTSW 11 61489172 missense probably benign 0.33
R7465:Mapk7 UTSW 11 61490453 missense probably damaging 1.00
R7797:Mapk7 UTSW 11 61489415 missense possibly damaging 0.72
Z1177:Mapk7 UTSW 11 61491362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTGGCACAAGTGACTGG -3'
(R):5'- AACTTTTCTGCAGATGGGCC -3'

Sequencing Primer
(F):5'- CACAAGTGACTGGGAGGCC -3'
(R):5'- GAAAGCCCGTGACAGCTCAG -3'
Posted On2019-12-04