Incidental Mutation 'RF031:Tedc2'
ID604381
Institutional Source Beutler Lab
Gene Symbol Tedc2
Ensembl Gene ENSMUSG00000024118
Gene Nametubulin epsilon and delta complex 2
Synonyms1600002H07Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.839) question?
Stock #RF031 (G1)
Quality Score214.458
Status Not validated
Chromosome17
Chromosomal Location24215054-24220851 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) AGGAACCCT to AGGAACCCTGGAACCCT at 24216239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024930]
Predicted Effect probably benign
Transcript: ENSMUST00000024930
SMART Domains Protein: ENSMUSP00000024930
Gene: ENSMUSG00000024118

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
low complexity region 78 84 N/A INTRINSIC
low complexity region 111 131 N/A INTRINSIC
Pfam:DUF4693 150 434 8.6e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124557
SMART Domains Protein: ENSMUSP00000119405
Gene: ENSMUSG00000024118

DomainStartEndE-ValueType
low complexity region 16 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Elovl5 G T 9: 77,981,473 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,490,234 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Zfp335 TCGTCGTC TCGTCGTCGTC 2: 164,907,463 probably benign Het
Other mutations in Tedc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Tedc2 APN 17 24217952 missense probably benign 0.01
IGL02111:Tedc2 APN 17 24218166 splice site probably benign
IGL02347:Tedc2 APN 17 24220610 missense probably damaging 1.00
IGL03400:Tedc2 APN 17 24219803 missense probably benign
R0766:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R0766:Tedc2 UTSW 17 24216318 nonsense probably null
R1066:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1066:Tedc2 UTSW 17 24216318 nonsense probably null
R1067:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1067:Tedc2 UTSW 17 24216318 nonsense probably null
R1085:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1085:Tedc2 UTSW 17 24216318 nonsense probably null
R1086:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1086:Tedc2 UTSW 17 24216318 nonsense probably null
R1136:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1136:Tedc2 UTSW 17 24216318 nonsense probably null
R1137:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1137:Tedc2 UTSW 17 24216318 nonsense probably null
R1203:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1203:Tedc2 UTSW 17 24216318 nonsense probably null
R1345:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1345:Tedc2 UTSW 17 24216318 nonsense probably null
R1385:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1385:Tedc2 UTSW 17 24216318 nonsense probably null
R1396:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1396:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1888:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1888:Tedc2 UTSW 17 24216318 nonsense probably null
R1891:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1891:Tedc2 UTSW 17 24216318 nonsense probably null
R1943:Tedc2 UTSW 17 24217949 missense possibly damaging 0.90
R1984:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1984:Tedc2 UTSW 17 24216318 nonsense probably null
R1985:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1985:Tedc2 UTSW 17 24216318 nonsense probably null
R1986:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R1986:Tedc2 UTSW 17 24216318 nonsense probably null
R2026:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2026:Tedc2 UTSW 17 24216318 nonsense probably null
R2054:Tedc2 UTSW 17 24216317 missense probably damaging 1.00
R2054:Tedc2 UTSW 17 24216318 nonsense probably null
R2086:Tedc2 UTSW 17 24217900 missense probably damaging 1.00
R2317:Tedc2 UTSW 17 24216384 missense probably benign 0.00
R3705:Tedc2 UTSW 17 24216387 missense probably benign 0.30
R4085:Tedc2 UTSW 17 24219839 missense probably benign 0.01
R4664:Tedc2 UTSW 17 24220140 splice site probably benign
R4676:Tedc2 UTSW 17 24220011 missense probably benign
R4686:Tedc2 UTSW 17 24217888 critical splice donor site probably null
R4762:Tedc2 UTSW 17 24216380 missense probably benign 0.05
R4837:Tedc2 UTSW 17 24220593 missense probably damaging 1.00
R4863:Tedc2 UTSW 17 24217936 missense probably damaging 1.00
R5936:Tedc2 UTSW 17 24216341 missense probably damaging 1.00
Z1177:Tedc2 UTSW 17 24220571 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAAGCCTGGGATAAGAACACTTC -3'
(R):5'- TGTGACAGAGCAACTTCCAGG -3'

Sequencing Primer
(F):5'- GGATAAGAACACTTCCACCCTCTTTC -3'
(R):5'- ACTTCCAGGAGAATGCCTTG -3'
Posted On2019-12-04