Incidental Mutation 'RF032:Olfr418'
ID 604392
Institutional Source Beutler Lab
Gene Symbol Olfr418
Ensembl Gene ENSMUSG00000049605
Gene Name olfactory receptor 418
Synonyms GA_x6K02T2P20D-20826777-20827719, MOR267-8, GA_x6K02T2R7CC-581296-580364, Olfr418-ps1, Olfr1403, MOR267-12P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # RF032 (G1)
Quality Score 217.468
Status Not validated
Chromosome 1
Chromosomal Location 173266001-173273994 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GTGACATC to G at 173270709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
AlphaFold A0A140T8J6
Predicted Effect probably null
Transcript: ENSMUST00000059754
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605

Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180

signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213420
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Olfr418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01418:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01930:Olfr418 APN 1 173270610 missense probably benign
IGL01963:Olfr418 APN 1 173270352 missense probably damaging 0.99
IGL02104:Olfr418 APN 1 173271036 missense probably damaging 0.96
IGL02192:Olfr418 APN 1 173270850 missense probably damaging 1.00
IGL02256:Olfr418 APN 1 173270627 missense probably benign 0.04
IGL02340:Olfr418 APN 1 173270405 missense probably benign 0.10
IGL02454:Olfr418 APN 1 173270940 missense probably damaging 0.99
IGL02638:Olfr418 APN 1 173270331 missense probably benign 0.07
FR4737:Olfr418 UTSW 1 173270630 frame shift probably null
FR4976:Olfr418 UTSW 1 173270630 frame shift probably null
R0552:Olfr418 UTSW 1 173270805 missense probably benign 0.05
R0621:Olfr418 UTSW 1 173270675 missense possibly damaging 0.48
R0735:Olfr418 UTSW 1 173271002 missense probably benign 0.05
R1506:Olfr418 UTSW 1 173270769 missense probably benign 0.04
R1670:Olfr418 UTSW 1 173270900 missense probably damaging 1.00
R2111:Olfr418 UTSW 1 173270312 missense probably benign
R2204:Olfr418 UTSW 1 173270136 splice site probably null
R4475:Olfr418 UTSW 1 173270913 missense probably damaging 0.99
R4909:Olfr418 UTSW 1 173270979 missense probably damaging 0.97
R5457:Olfr418 UTSW 1 173270574 missense probably benign 0.00
R6124:Olfr418 UTSW 1 173270279 missense probably damaging 1.00
R6456:Olfr418 UTSW 1 173270538 missense probably damaging 1.00
R7220:Olfr418 UTSW 1 173270244 missense possibly damaging 0.56
R7240:Olfr418 UTSW 1 173270994 missense probably benign 0.27
R7672:Olfr418 UTSW 1 173270873 missense probably benign 0.18
R8073:Olfr418 UTSW 1 173270985 missense probably benign 0.42
R8116:Olfr418 UTSW 1 173270480 missense possibly damaging 0.88
R8982:Olfr418 UTSW 1 173270739 missense probably damaging 1.00
R9038:Olfr418 UTSW 1 173270580 missense possibly damaging 0.63
R9668:Olfr418 UTSW 1 173270616 missense possibly damaging 0.94
RF036:Olfr418 UTSW 1 173270709 frame shift probably null
RF040:Olfr418 UTSW 1 173270709 frame shift probably null
X0019:Olfr418 UTSW 1 173270557 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04