Incidental Mutation 'RF032:Slc12a1'
ID 604397
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Name solute carrier family 12, member 1
Synonyms urehr3, mBSC1, Nkcc2, D630042G03Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # RF032 (G1)
Quality Score 214.458
Status Not validated
Chromosome 2
Chromosomal Location 125152505-125230002 bp(+) (GRCm38)
Type of Mutation small insertion (5 aa in frame mutation)
DNA Base Change (assembly) ACAAACC to ACAAACCTTTGGCCACCAAACC at 125154210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028630
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110494
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110495
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 (GRCm38) probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 (GRCm38) probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 (GRCm38) probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 (GRCm38) probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 (GRCm38) probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 (GRCm38) probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 (GRCm38) probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 (GRCm38) probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 (GRCm38) probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 (GRCm38) probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 (GRCm38) probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 (GRCm38) probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 (GRCm38) probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 (GRCm38) probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 (GRCm38) probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 (GRCm38) probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 (GRCm38) probably null Het
Med12l CAG CAGAAG 3: 59,275,981 (GRCm38) probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 (GRCm38) probably benign Het
Med12l GCA GCACCA 3: 59,275,989 (GRCm38) probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 (GRCm38) probably benign Het
Nf2 AAAAG A 11: 4,829,936 (GRCm38) probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 (GRCm38) probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 (GRCm38) probably null Het
Padi3 TCTCAC TC 4: 140,792,972 (GRCm38) probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 (GRCm38) probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 (GRCm38) probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 (GRCm38) probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 (GRCm38) probably null Het
Smpx CCCCCCA C X: 157,720,923 (GRCm38) probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 (GRCm38) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 (GRCm38) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 (GRCm38) probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 (GRCm38) probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 (GRCm38) probably benign Het
Vat1l C T 8: 114,289,329 (GRCm38) L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 (GRCm38) probably benign Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125,188,194 (GRCm38) missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125,188,238 (GRCm38) missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125,194,131 (GRCm38) missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125,217,910 (GRCm38) missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125,178,149 (GRCm38) splice site probably benign
IGL02150:Slc12a1 APN 2 125,184,815 (GRCm38) missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125,188,270 (GRCm38) critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125,184,728 (GRCm38) missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125,154,242 (GRCm38) missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125,170,691 (GRCm38) missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125,225,978 (GRCm38) missense probably benign
IGL02672:Slc12a1 APN 2 125,170,676 (GRCm38) missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125,161,079 (GRCm38) nonsense probably null
IGL03191:Slc12a1 APN 2 125,206,089 (GRCm38) missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125,154,216 (GRCm38) small insertion probably benign
FR4548:Slc12a1 UTSW 2 125,154,214 (GRCm38) small insertion probably benign
FR4737:Slc12a1 UTSW 2 125,154,214 (GRCm38) small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125,190,204 (GRCm38) missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125,214,009 (GRCm38) missense probably benign
R0127:Slc12a1 UTSW 2 125,219,762 (GRCm38) missense probably damaging 1.00
R0312:Slc12a1 UTSW 2 125,226,028 (GRCm38) missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125,226,031 (GRCm38) missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125,194,162 (GRCm38) nonsense probably null
R1194:Slc12a1 UTSW 2 125,184,767 (GRCm38) missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125,218,238 (GRCm38) missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125,190,295 (GRCm38) missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125,184,857 (GRCm38) missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125,194,193 (GRCm38) missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125,173,699 (GRCm38) missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125,173,681 (GRCm38) missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125,154,151 (GRCm38) missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125,188,193 (GRCm38) missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125,200,623 (GRCm38) missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125,226,044 (GRCm38) missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125,186,641 (GRCm38) missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125,153,993 (GRCm38) missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125,161,079 (GRCm38) nonsense probably null
R4845:Slc12a1 UTSW 2 125,188,226 (GRCm38) missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125,228,750 (GRCm38) missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125,166,137 (GRCm38) missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125,218,224 (GRCm38) missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125,217,889 (GRCm38) missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125,170,714 (GRCm38) missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125,190,213 (GRCm38) missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125,184,815 (GRCm38) missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125,214,079 (GRCm38) missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125,160,534 (GRCm38) missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125,171,257 (GRCm38) missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125,200,622 (GRCm38) missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125,214,132 (GRCm38) missense probably benign
R7428:Slc12a1 UTSW 2 125,214,132 (GRCm38) missense probably benign
R7432:Slc12a1 UTSW 2 125,206,040 (GRCm38) missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125,217,895 (GRCm38) nonsense probably null
R7828:Slc12a1 UTSW 2 125,166,682 (GRCm38) missense possibly damaging 0.85
R7862:Slc12a1 UTSW 2 125,161,094 (GRCm38) missense probably damaging 0.99
R7923:Slc12a1 UTSW 2 125,214,092 (GRCm38) missense possibly damaging 0.75
R8020:Slc12a1 UTSW 2 125,178,102 (GRCm38) missense possibly damaging 0.78
R8071:Slc12a1 UTSW 2 125,186,314 (GRCm38) missense probably damaging 1.00
R8272:Slc12a1 UTSW 2 125,228,816 (GRCm38) missense probably damaging 1.00
R8302:Slc12a1 UTSW 2 125,190,289 (GRCm38) missense probably damaging 0.99
R8722:Slc12a1 UTSW 2 125,160,598 (GRCm38) missense probably damaging 1.00
R9029:Slc12a1 UTSW 2 125,154,084 (GRCm38) missense probably benign
R9153:Slc12a1 UTSW 2 125,161,069 (GRCm38) splice site probably benign
R9449:Slc12a1 UTSW 2 125,186,224 (GRCm38) missense probably damaging 1.00
R9568:Slc12a1 UTSW 2 125,190,298 (GRCm38) missense probably damaging 1.00
R9614:Slc12a1 UTSW 2 125,160,525 (GRCm38) missense probably damaging 0.99
R9723:Slc12a1 UTSW 2 125,217,907 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCATGTTATAAACGAGGGC -3'
(R):5'- TGCCCACCACTTATGATGCAG -3'

Sequencing Primer
(F):5'- TCCATGTTATAAACGAGGGCCATGG -3'
(R):5'- ACCACTTATGATGCAGTGTTTTC -3'
Posted On 2019-12-04