Incidental Mutation 'RF032:Pou3f1'
ID 604403
Institutional Source Beutler Lab
Gene Symbol Pou3f1
Ensembl Gene ENSMUSG00000090125
Gene Name POU domain, class 3, transcription factor 1
Synonyms Scip, Otf6, Oct6, Tst1, Test1, Oct-6, Tst-1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # RF032 (G1)
Quality Score 188.79
Status Not validated
Chromosome 4
Chromosomal Location 124551439-124554448 bp(+) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) GGCGGCCG to GGCGGCCGCGGCCG at 124551598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053491]
AlphaFold P21952
PDB Structure CRYSTAL STRUCTURE OF THE DIMERIC OCT-6 (POU3F1) POU DOMAIN BOUND TO PALINDROMIC MORE DNA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000053491
SMART Domains Protein: ENSMUSP00000137374
Gene: ENSMUSG00000090125

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 75 109 N/A INTRINSIC
low complexity region 116 134 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
low complexity region 154 189 N/A INTRINSIC
low complexity region 202 236 N/A INTRINSIC
POU 245 319 1.26e-52 SMART
HOX 337 399 2.15e-17 SMART
low complexity region 411 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cyanosis and respiratory distress at birth and defective peripheral myelination due to arrested Scwann cell maturation. Mutants usually die at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,506,701 (GRCm39) probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,989,559 (GRCm39) probably benign Het
Arid1b GCG GCGTCG 17: 5,045,863 (GRCm39) probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,162,678 (GRCm39) probably benign Het
Cacna1f GAG GAGTAG X: 7,486,302 (GRCm39) probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,129,722 (GRCm39) probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,560,341 (GRCm39) probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,466 (GRCm39) probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,466,607 (GRCm39) probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,602,083 (GRCm39) probably benign Het
Enah TGGCGGTGG TG 1: 181,749,494 (GRCm39) probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,489,142 (GRCm39) probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,431,186 (GRCm39) probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,562,723 (GRCm39) probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 67,875,927 (GRCm39) probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,019,979 (GRCm39) probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,530,501 (GRCm39) probably null Het
Med12l CAG CAGAAG 3: 59,183,402 (GRCm39) probably benign Het
Med12l GCA GCACCA 3: 59,183,410 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,406 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,577 (GRCm39) probably benign Het
Nf2 AAAAG A 11: 4,779,936 (GRCm39) probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Pik3c2g G GGAGA 6: 139,612,656 (GRCm39) probably null Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,756,798 (GRCm39) probably benign Het
Reep1 CC CCCGAC 6: 71,684,952 (GRCm39) probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 124,996,130 (GRCm39) probably benign Het
Smpx CCCCCCA C X: 156,503,919 (GRCm39) probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,087 (GRCm39) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,593,046 (GRCm39) probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,593,057 (GRCm39) probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,851,236 (GRCm39) probably benign Het
Vat1l C T 8: 115,016,069 (GRCm39) L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 109,682,724 (GRCm39) probably benign Het
Other mutations in Pou3f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Pou3f1 APN 4 124,552,650 (GRCm39) missense probably damaging 1.00
IGL02981:Pou3f1 APN 4 124,552,236 (GRCm39) missense probably damaging 0.99
R0433:Pou3f1 UTSW 4 124,552,697 (GRCm39) missense probably damaging 1.00
R4606:Pou3f1 UTSW 4 124,552,629 (GRCm39) missense probably damaging 1.00
R5033:Pou3f1 UTSW 4 124,552,449 (GRCm39) missense probably damaging 1.00
R7807:Pou3f1 UTSW 4 124,552,074 (GRCm39) missense possibly damaging 0.85
R7891:Pou3f1 UTSW 4 124,552,232 (GRCm39) missense probably damaging 0.99
R8008:Pou3f1 UTSW 4 124,552,764 (GRCm39) missense unknown
R8691:Pou3f1 UTSW 4 124,551,549 (GRCm39) missense unknown
R8782:Pou3f1 UTSW 4 124,552,807 (GRCm39) small deletion probably benign
R8888:Pou3f1 UTSW 4 124,552,152 (GRCm39) missense possibly damaging 0.70
R8922:Pou3f1 UTSW 4 124,552,176 (GRCm39) missense possibly damaging 0.85
R9492:Pou3f1 UTSW 4 124,552,179 (GRCm39) missense possibly damaging 0.53
R9513:Pou3f1 UTSW 4 124,552,835 (GRCm39) missense probably benign 0.04
RF016:Pou3f1 UTSW 4 124,551,602 (GRCm39) small insertion probably benign
RF050:Pou3f1 UTSW 4 124,551,597 (GRCm39) small insertion probably benign
RF055:Pou3f1 UTSW 4 124,551,589 (GRCm39) small insertion probably benign
RF060:Pou3f1 UTSW 4 124,551,602 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCGGGTCCGGGCTTTAAG -3'
(R):5'- CCCAAGTGGTGCGCTGTG -3'

Sequencing Primer
(F):5'- GCTTTAAGCCGGCGGAG -3'
(R):5'- CTGCCTTGCCGTGTTCCAG -3'
Posted On 2019-12-04