Incidental Mutation 'RF032:Pou3f1'
ID604403
Institutional Source Beutler Lab
Gene Symbol Pou3f1
Ensembl Gene ENSMUSG00000090125
Gene NamePOU domain, class 3, transcription factor 1
SynonymsOct-6, Otf6, Tst1, Scip, Test1, Tst-1, Oct6
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF032 (G1)
Quality Score188.79
Status Not validated
Chromosome4
Chromosomal Location124656807-124660655 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GGCGGCCG to GGCGGCCGCGGCCG at 124657805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053491]
PDB Structure CRYSTAL STRUCTURE OF THE DIMERIC OCT-6 (POU3F1) POU DOMAIN BOUND TO PALINDROMIC MORE DNA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000053491
SMART Domains Protein: ENSMUSP00000137374
Gene: ENSMUSG00000090125

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 75 109 N/A INTRINSIC
low complexity region 116 134 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
low complexity region 154 189 N/A INTRINSIC
low complexity region 202 236 N/A INTRINSIC
POU 245 319 1.26e-52 SMART
HOX 337 399 2.15e-17 SMART
low complexity region 411 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit cyanosis and respiratory distress at birth and defective peripheral myelination due to arrested Scwann cell maturation. Mutants usually die at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Pou3f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Pou3f1 APN 4 124658857 missense probably damaging 1.00
IGL02981:Pou3f1 APN 4 124658443 missense probably damaging 0.99
R0433:Pou3f1 UTSW 4 124658904 missense probably damaging 1.00
R4606:Pou3f1 UTSW 4 124658836 missense probably damaging 1.00
R5033:Pou3f1 UTSW 4 124658656 missense probably damaging 1.00
R7807:Pou3f1 UTSW 4 124658281 missense possibly damaging 0.85
R7891:Pou3f1 UTSW 4 124658439 missense probably damaging 0.99
R8008:Pou3f1 UTSW 4 124658971 missense unknown
R8691:Pou3f1 UTSW 4 124657756 missense unknown
R8782:Pou3f1 UTSW 4 124659014 small deletion probably benign
RF016:Pou3f1 UTSW 4 124657809 small insertion probably benign
RF050:Pou3f1 UTSW 4 124657804 small insertion probably benign
RF055:Pou3f1 UTSW 4 124657796 small insertion probably benign
RF060:Pou3f1 UTSW 4 124657809 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCGGGTCCGGGCTTTAAG -3'
(R):5'- CCCAAGTGGTGCGCTGTG -3'

Sequencing Primer
(F):5'- GCTTTAAGCCGGCGGAG -3'
(R):5'- CTGCCTTGCCGTGTTCCAG -3'
Posted On2019-12-04