Incidental Mutation 'RF032:Padi3'
ID 604404
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Name peptidyl arginine deiminase, type III
Synonyms Pdi3, Pad3, PAD type III
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # RF032 (G1)
Quality Score 197.544
Status Not validated
Chromosome 4
Chromosomal Location 140512680-140537959 bp(-) (GRCm39)
Type of Mutation critical splice donor site
DNA Base Change (assembly) TCTCAC to TC at 140520283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]
AlphaFold Q9Z184
Predicted Effect probably benign
Transcript: ENSMUST00000026377
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172098
SMART Domains Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 14 103 3.9e-29 PFAM
Pfam:PAD_M 105 263 2.9e-69 PFAM
Pfam:PAD 268 654 5.3e-226 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,506,701 (GRCm39) probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,989,559 (GRCm39) probably benign Het
Arid1b GCG GCGTCG 17: 5,045,863 (GRCm39) probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,162,678 (GRCm39) probably benign Het
Cacna1f GAG GAGTAG X: 7,486,302 (GRCm39) probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,129,722 (GRCm39) probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,560,341 (GRCm39) probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,466 (GRCm39) probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,466,607 (GRCm39) probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,602,083 (GRCm39) probably benign Het
Enah TGGCGGTGG TG 1: 181,749,494 (GRCm39) probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,489,142 (GRCm39) probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,431,186 (GRCm39) probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,562,723 (GRCm39) probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 67,875,927 (GRCm39) probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,019,979 (GRCm39) probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,530,501 (GRCm39) probably null Het
Med12l CAG CAGAAG 3: 59,183,402 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,406 (GRCm39) probably benign Het
Med12l GCA GCACCA 3: 59,183,410 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,577 (GRCm39) probably benign Het
Nf2 AAAAG A 11: 4,779,936 (GRCm39) probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Pik3c2g G GGAGA 6: 139,612,656 (GRCm39) probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,551,598 (GRCm39) probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,756,798 (GRCm39) probably benign Het
Reep1 CC CCCGAC 6: 71,684,952 (GRCm39) probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 124,996,130 (GRCm39) probably benign Het
Smpx CCCCCCA C X: 156,503,919 (GRCm39) probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,087 (GRCm39) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,593,046 (GRCm39) probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,593,057 (GRCm39) probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,851,236 (GRCm39) probably benign Het
Vat1l C T 8: 115,016,069 (GRCm39) L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 109,682,724 (GRCm39) probably benign Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140,530,935 (GRCm39) missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140,516,254 (GRCm39) missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140,516,254 (GRCm39) missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140,523,645 (GRCm39) splice site probably benign
IGL02400:Padi3 APN 4 140,516,179 (GRCm39) missense probably benign 0.00
IGL02449:Padi3 APN 4 140,517,023 (GRCm39) critical splice donor site probably null
IGL02600:Padi3 APN 4 140,525,467 (GRCm39) missense probably benign 0.15
IGL03342:Padi3 APN 4 140,537,909 (GRCm39) nonsense probably null
FR4304:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140,518,794 (GRCm39) missense probably benign 0.00
R0455:Padi3 UTSW 4 140,523,024 (GRCm39) missense probably damaging 1.00
R0743:Padi3 UTSW 4 140,513,740 (GRCm39) missense probably benign 0.00
R1279:Padi3 UTSW 4 140,530,888 (GRCm39) missense probably benign 0.00
R2081:Padi3 UTSW 4 140,526,290 (GRCm39) missense probably damaging 1.00
R3016:Padi3 UTSW 4 140,513,898 (GRCm39) missense probably damaging 1.00
R3853:Padi3 UTSW 4 140,518,580 (GRCm39) splice site probably benign
R4599:Padi3 UTSW 4 140,525,422 (GRCm39) missense probably damaging 1.00
R4909:Padi3 UTSW 4 140,522,937 (GRCm39) missense probably damaging 1.00
R5370:Padi3 UTSW 4 140,537,849 (GRCm39) nonsense probably null
R5482:Padi3 UTSW 4 140,523,154 (GRCm39) missense probably damaging 0.99
R6084:Padi3 UTSW 4 140,523,154 (GRCm39) missense probably damaging 1.00
R6151:Padi3 UTSW 4 140,523,705 (GRCm39) missense probably damaging 1.00
R6277:Padi3 UTSW 4 140,518,472 (GRCm39) critical splice donor site probably null
R6343:Padi3 UTSW 4 140,530,819 (GRCm39) missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140,523,164 (GRCm39) missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140,527,435 (GRCm39) missense probably damaging 1.00
R7403:Padi3 UTSW 4 140,527,430 (GRCm39) missense probably benign
R7798:Padi3 UTSW 4 140,513,750 (GRCm39) missense probably benign
R7818:Padi3 UTSW 4 140,525,453 (GRCm39) missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140,525,407 (GRCm39) missense probably damaging 1.00
R8887:Padi3 UTSW 4 140,523,795 (GRCm39) nonsense probably null
R9036:Padi3 UTSW 4 140,523,004 (GRCm39) missense probably benign 0.00
R9339:Padi3 UTSW 4 140,522,928 (GRCm39) missense probably benign 0.11
R9403:Padi3 UTSW 4 140,537,843 (GRCm39) missense probably benign
RF025:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
RF040:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
RF043:Padi3 UTSW 4 140,520,283 (GRCm39) critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140,525,434 (GRCm39) missense not run
Z1176:Padi3 UTSW 4 140,522,982 (GRCm39) missense possibly damaging 0.92
Z1177:Padi3 UTSW 4 140,525,434 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- TCTCTGGGCCCCTTGTAAAG -3'
(R):5'- CTGAGCCTGGACTTGACAAGAG -3'

Sequencing Primer
(F):5'- TTGTAAAGGAAAGGGTTGGACTTAAC -3'
(R):5'- ATCACAAGCGGTCAGGCTCTTC -3'
Posted On 2019-12-04