Incidental Mutation 'RF032:Padi3'
ID604404
Institutional Source Beutler Lab
Gene Symbol Padi3
Ensembl Gene ENSMUSG00000025328
Gene Namepeptidyl arginine deiminase, type III
SynonymsPAD type III, Pdi3, Pad3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF032 (G1)
Quality Score197.544
Status Not validated
Chromosome4
Chromosomal Location140785365-140810648 bp(-) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) TCTCAC to TC at 140792972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000172098]
Predicted Effect probably benign
Transcript: ENSMUST00000026377
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172098
SMART Domains Protein: ENSMUSP00000130721
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 14 103 3.9e-29 PFAM
Pfam:PAD_M 105 263 2.9e-69 PFAM
Pfam:PAD 268 654 5.3e-226 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type III enzyme modulates hair structural proteins, such as filaggrin in the hair follicle and trichohyalin in the inner root sheath, during hair follicle formation. Together with the type I enzyme, this enzyme may also play a role in terminal differentiation of the epidermis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit alterations in coat/ hair and vibrissa morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Padi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Padi3 APN 4 140803624 missense possibly damaging 0.78
IGL00948:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL00949:Padi3 APN 4 140788943 missense possibly damaging 0.92
IGL01021:Padi3 APN 4 140796334 splice site probably benign
IGL02400:Padi3 APN 4 140788868 missense probably benign 0.00
IGL02449:Padi3 APN 4 140789712 critical splice donor site probably null
IGL02600:Padi3 APN 4 140798156 missense probably benign 0.15
IGL03342:Padi3 APN 4 140810598 nonsense probably null
FR4304:Padi3 UTSW 4 140792972 critical splice donor site probably benign
PIT4544001:Padi3 UTSW 4 140791483 missense probably benign 0.00
R0455:Padi3 UTSW 4 140795713 missense probably damaging 1.00
R0743:Padi3 UTSW 4 140786429 missense probably benign 0.00
R1279:Padi3 UTSW 4 140803577 missense probably benign 0.00
R2081:Padi3 UTSW 4 140798979 missense probably damaging 1.00
R3016:Padi3 UTSW 4 140786587 missense probably damaging 1.00
R3853:Padi3 UTSW 4 140791269 splice site probably benign
R4599:Padi3 UTSW 4 140798111 missense probably damaging 1.00
R4909:Padi3 UTSW 4 140795626 missense probably damaging 1.00
R5370:Padi3 UTSW 4 140810538 nonsense probably null
R5482:Padi3 UTSW 4 140795843 missense probably damaging 0.99
R6084:Padi3 UTSW 4 140795843 missense probably damaging 1.00
R6151:Padi3 UTSW 4 140796394 missense probably damaging 1.00
R6277:Padi3 UTSW 4 140791161 critical splice donor site probably null
R6343:Padi3 UTSW 4 140803508 missense possibly damaging 0.58
R6749:Padi3 UTSW 4 140795853 missense possibly damaging 0.94
R7096:Padi3 UTSW 4 140800124 missense probably damaging 1.00
R7403:Padi3 UTSW 4 140800119 missense probably benign
R7798:Padi3 UTSW 4 140786439 missense probably benign
R7818:Padi3 UTSW 4 140798142 missense possibly damaging 0.72
R8375:Padi3 UTSW 4 140798096 missense probably damaging 1.00
RF025:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF040:Padi3 UTSW 4 140792972 critical splice donor site probably benign
RF043:Padi3 UTSW 4 140792972 critical splice donor site probably benign
Z1176:Padi3 UTSW 4 140795671 missense possibly damaging 0.92
Z1176:Padi3 UTSW 4 140798123 missense not run
Z1177:Padi3 UTSW 4 140798123 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCTGGGCCCCTTGTAAAG -3'
(R):5'- CTGAGCCTGGACTTGACAAGAG -3'

Sequencing Primer
(F):5'- TTGTAAAGGAAAGGGTTGGACTTAAC -3'
(R):5'- ATCACAAGCGGTCAGGCTCTTC -3'
Posted On2019-12-04