Incidental Mutation 'RF032:Efhd2'
ID604405
Institutional Source Beutler Lab
Gene Symbol Efhd2
Ensembl Gene ENSMUSG00000040659
Gene NameEF hand domain containing 2
Synonymsswiprosin 1, D4Wsu27e, 2600015J22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #RF032 (G1)
Quality Score216.257
Status Not validated
Chromosome4
Chromosomal Location141858142-141874920 bp(-) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CGCC to CGCCGCAGCC at 141874772 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036854]
Predicted Effect probably benign
Transcript: ENSMUST00000036854
SMART Domains Protein: ENSMUSP00000044502
Gene: ENSMUSG00000040659

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
EFh 96 124 1.44e-2 SMART
EFh 132 160 2.71e0 SMART
coiled coil region 199 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced germinal center responses and humoral type 2 immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Efhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Efhd2 APN 4 141859865 missense probably benign 0.05
IGL01710:Efhd2 APN 4 141860561 missense probably damaging 1.00
IGL01869:Efhd2 APN 4 141874602 missense probably damaging 1.00
FR4589:Efhd2 UTSW 4 141874764 small insertion probably benign
R0109:Efhd2 UTSW 4 141874567 missense probably benign 0.00
R0711:Efhd2 UTSW 4 141859872 missense probably damaging 1.00
R6861:Efhd2 UTSW 4 141859881 splice site probably null
R7765:Efhd2 UTSW 4 141874575 missense probably damaging 0.97
R8275:Efhd2 UTSW 4 141874762 missense probably benign 0.31
R8504:Efhd2 UTSW 4 141859875 nonsense probably null
RF008:Efhd2 UTSW 4 141874758 small insertion probably benign
RF010:Efhd2 UTSW 4 141874764 small insertion probably benign
RF012:Efhd2 UTSW 4 141874768 small insertion probably benign
RF015:Efhd2 UTSW 4 141874756 small insertion probably benign
RF016:Efhd2 UTSW 4 141874756 small insertion probably benign
RF021:Efhd2 UTSW 4 141874773 small insertion probably benign
RF023:Efhd2 UTSW 4 141874762 small insertion probably benign
RF024:Efhd2 UTSW 4 141874762 small insertion probably benign
RF025:Efhd2 UTSW 4 141874771 small insertion probably benign
RF044:Efhd2 UTSW 4 141874768 small insertion probably benign
RF056:Efhd2 UTSW 4 141874767 small insertion probably benign
RF057:Efhd2 UTSW 4 141874769 small insertion probably benign
RF062:Efhd2 UTSW 4 141874755 small insertion probably benign
RF062:Efhd2 UTSW 4 141874774 small insertion probably benign
RF064:Efhd2 UTSW 4 141874755 small insertion probably benign
Z1177:Efhd2 UTSW 4 141874683 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAACTCGGTGTAGGG -3'
(R):5'- ACCCAGAGGTCATCAGAGAG -3'

Sequencing Primer
(F):5'- ACTCGGTGTAGGGGTTGAAGAC -3'
(R):5'- TAAGTCCCACCTTCAGGGC -3'
Posted On2019-12-04