Incidental Mutation 'RF032:Efhd2'
ID 604405
Institutional Source Beutler Lab
Gene Symbol Efhd2
Ensembl Gene ENSMUSG00000040659
Gene Name EF hand domain containing 2
Synonyms D4Wsu27e, 2600015J22Rik, swiprosin 1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # RF032 (G1)
Quality Score 216.257
Status Not validated
Chromosome 4
Chromosomal Location 141585453-141602231 bp(-) (GRCm39)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CGCC to CGCCGCAGCC at 141602083 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036854]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036854
SMART Domains Protein: ENSMUSP00000044502
Gene: ENSMUSG00000040659

DomainStartEndE-ValueType
low complexity region 32 47 N/A INTRINSIC
EFh 96 124 1.44e-2 SMART
EFh 132 160 2.71e0 SMART
coiled coil region 199 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced germinal center responses and humoral type 2 immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,506,701 (GRCm39) probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,989,559 (GRCm39) probably benign Het
Arid1b GCG GCGTCG 17: 5,045,863 (GRCm39) probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,162,678 (GRCm39) probably benign Het
Cacna1f GAG GAGTAG X: 7,486,302 (GRCm39) probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,129,722 (GRCm39) probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,560,341 (GRCm39) probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 86,922,466 (GRCm39) probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,466,607 (GRCm39) probably benign Het
Enah TGGCGGTGG TG 1: 181,749,494 (GRCm39) probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,489,142 (GRCm39) probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,431,186 (GRCm39) probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,562,723 (GRCm39) probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 67,875,927 (GRCm39) probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,019,979 (GRCm39) probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,530,501 (GRCm39) probably null Het
Med12l CAG CAGAAG 3: 59,183,402 (GRCm39) probably benign Het
Med12l GCA GCACCA 3: 59,183,410 (GRCm39) probably benign Het
Med12l AGC AGCGGC 3: 59,183,406 (GRCm39) probably benign Het
Mn1 CAG CAGAAG 5: 111,567,577 (GRCm39) probably benign Het
Nf2 AAAAG A 11: 4,779,936 (GRCm39) probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,458,068 (GRCm39) probably benign Het
Or10j2 GTGACATC G 1: 173,098,276 (GRCm39) probably null Het
Padi3 TCTCAC TC 4: 140,520,283 (GRCm39) probably benign Het
Pik3c2g G GGAGA 6: 139,612,656 (GRCm39) probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,551,598 (GRCm39) probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,756,798 (GRCm39) probably benign Het
Reep1 CC CCCGAC 6: 71,684,952 (GRCm39) probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 124,996,130 (GRCm39) probably benign Het
Smpx CCCCCCA C X: 156,503,919 (GRCm39) probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 (GRCm39) probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,635,087 (GRCm39) probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,593,046 (GRCm39) probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,593,057 (GRCm39) probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,851,236 (GRCm39) probably benign Het
Vat1l C T 8: 115,016,069 (GRCm39) L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 109,682,724 (GRCm39) probably benign Het
Other mutations in Efhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Efhd2 APN 4 141,587,176 (GRCm39) missense probably benign 0.05
IGL01710:Efhd2 APN 4 141,587,872 (GRCm39) missense probably damaging 1.00
IGL01869:Efhd2 APN 4 141,601,913 (GRCm39) missense probably damaging 1.00
FR4589:Efhd2 UTSW 4 141,602,075 (GRCm39) small insertion probably benign
R0109:Efhd2 UTSW 4 141,601,878 (GRCm39) missense probably benign 0.00
R0711:Efhd2 UTSW 4 141,587,183 (GRCm39) missense probably damaging 1.00
R6861:Efhd2 UTSW 4 141,587,192 (GRCm39) splice site probably null
R7765:Efhd2 UTSW 4 141,601,886 (GRCm39) missense probably damaging 0.97
R8275:Efhd2 UTSW 4 141,602,073 (GRCm39) missense probably benign 0.31
R8504:Efhd2 UTSW 4 141,587,186 (GRCm39) nonsense probably null
RF008:Efhd2 UTSW 4 141,602,069 (GRCm39) small insertion probably benign
RF010:Efhd2 UTSW 4 141,602,075 (GRCm39) small insertion probably benign
RF012:Efhd2 UTSW 4 141,602,079 (GRCm39) small insertion probably benign
RF015:Efhd2 UTSW 4 141,602,067 (GRCm39) small insertion probably benign
RF016:Efhd2 UTSW 4 141,602,067 (GRCm39) small insertion probably benign
RF021:Efhd2 UTSW 4 141,602,084 (GRCm39) small insertion probably benign
RF023:Efhd2 UTSW 4 141,602,073 (GRCm39) small insertion probably benign
RF024:Efhd2 UTSW 4 141,602,073 (GRCm39) small insertion probably benign
RF025:Efhd2 UTSW 4 141,602,082 (GRCm39) small insertion probably benign
RF044:Efhd2 UTSW 4 141,602,079 (GRCm39) small insertion probably benign
RF056:Efhd2 UTSW 4 141,602,078 (GRCm39) small insertion probably benign
RF057:Efhd2 UTSW 4 141,602,080 (GRCm39) small insertion probably benign
RF062:Efhd2 UTSW 4 141,602,085 (GRCm39) small insertion probably benign
RF062:Efhd2 UTSW 4 141,602,066 (GRCm39) small insertion probably benign
RF064:Efhd2 UTSW 4 141,602,066 (GRCm39) small insertion probably benign
Z1177:Efhd2 UTSW 4 141,601,994 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGAACTCGGTGTAGGG -3'
(R):5'- ACCCAGAGGTCATCAGAGAG -3'

Sequencing Primer
(F):5'- ACTCGGTGTAGGGGTTGAAGAC -3'
(R):5'- TAAGTCCCACCTTCAGGGC -3'
Posted On 2019-12-04