Incidental Mutation 'RF032:Reep1'
ID 604409
Institutional Source Beutler Lab
Gene Symbol Reep1
Ensembl Gene ENSMUSG00000052852
Gene Name receptor accessory protein 1
Synonyms D6Ertd253e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF032 (G1)
Quality Score 193.468
Status Not validated
Chromosome 6
Chromosomal Location 71707561-71810710 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) CC to CCCGAC at 71707968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121469] [ENSMUST00000212631] [ENSMUST00000212792]
AlphaFold Q8BGH4
Predicted Effect probably null
Transcript: ENSMUST00000121469
SMART Domains Protein: ENSMUSP00000112662
Gene: ENSMUSG00000052852

Pfam:TB2_DP1_HVA22 7 95 1.1e-35 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 160 180 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212631
Predicted Effect probably null
Transcript: ENSMUST00000212792
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that functions to enhance the cell surface expression of odorant receptors. Mutations in this gene cause spastic paraplegia autosomal dominant type 31, a neurodegenerative disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spastic paraplegia in aged mice with reduced ER complexity in cortical motor neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Reep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Reep1 APN 6 71773288 missense probably damaging 1.00
IGL03057:Reep1 APN 6 71807781 splice site probably benign
R1596:Reep1 UTSW 6 71756437 critical splice donor site probably null
R1899:Reep1 UTSW 6 71780797 missense probably benign 0.32
R2201:Reep1 UTSW 6 71773294 missense probably damaging 1.00
R2252:Reep1 UTSW 6 71756442 splice site probably null
R3787:Reep1 UTSW 6 71795215 missense probably damaging 0.98
R4760:Reep1 UTSW 6 71708001 missense possibly damaging 0.67
R5657:Reep1 UTSW 6 71761374 missense possibly damaging 0.89
R6619:Reep1 UTSW 6 71807842 utr 3 prime probably benign
R6659:Reep1 UTSW 6 71773195 missense probably damaging 1.00
R7080:Reep1 UTSW 6 71780765 missense possibly damaging 0.81
R7299:Reep1 UTSW 6 71761389 missense probably benign 0.02
R7730:Reep1 UTSW 6 71780741 missense possibly damaging 0.64
R9333:Reep1 UTSW 6 71795214 missense probably damaging 0.99
R9486:Reep1 UTSW 6 71707985 missense probably benign 0.00
RF019:Reep1 UTSW 6 71707969 start codon destroyed probably null
RF023:Reep1 UTSW 6 71707968 start codon destroyed probably null
RF029:Reep1 UTSW 6 71707966 start codon destroyed probably null
RF042:Reep1 UTSW 6 71707966 start codon destroyed probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2019-12-04