Incidental Mutation 'RF032:Dmkn'
ID604413
Institutional Source Beutler Lab
Gene Symbol Dmkn
Ensembl Gene ENSMUSG00000060962
Gene Namedermokine
Synonymssk30, 1110014F24Rik, sk89, Dmkn, cI-36, dermokine
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #RF032 (G1)
Quality Score217.468
Status Not validated
Chromosome7
Chromosomal Location30763756-30781063 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) GT to GTTGTGAAAGTGGTGGAAGTGGTGGAATT at 30767182 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054427] [ENSMUST00000085688] [ENSMUST00000085691] [ENSMUST00000165887] [ENSMUST00000188578]
Predicted Effect probably benign
Transcript: ENSMUST00000054427
SMART Domains Protein: ENSMUSP00000060362
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 5.96e-5 PROSPERO
internal_repeat_2 25 53 3.87e-5 PROSPERO
internal_repeat_2 45 73 3.87e-5 PROSPERO
internal_repeat_3 65 94 5.96e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 312 331 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
internal_repeat_1 387 414 3.28e-7 PROSPERO
internal_repeat_1 422 449 3.28e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085688
SMART Domains Protein: ENSMUSP00000082831
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.61e-5 PROSPERO
internal_repeat_2 25 53 4.31e-5 PROSPERO
internal_repeat_2 45 73 4.31e-5 PROSPERO
internal_repeat_3 65 94 6.61e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 308 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
internal_repeat_1 363 390 3.84e-7 PROSPERO
internal_repeat_1 398 425 3.84e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000085691
SMART Domains Protein: ENSMUSP00000082834
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_3 22 50 6.12e-5 PROSPERO
internal_repeat_2 25 53 3.97e-5 PROSPERO
internal_repeat_2 45 73 3.97e-5 PROSPERO
internal_repeat_3 65 94 6.12e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 350 N/A INTRINSIC
internal_repeat_1 378 405 3.43e-7 PROSPERO
internal_repeat_1 413 440 3.43e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000165887
SMART Domains Protein: ENSMUSP00000129031
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
internal_repeat_2 25 53 9.56e-5 PROSPERO
internal_repeat_2 45 73 9.56e-5 PROSPERO
low complexity region 123 151 N/A INTRINSIC
low complexity region 161 176 N/A INTRINSIC
low complexity region 211 290 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
internal_repeat_1 394 421 1.01e-6 PROSPERO
internal_repeat_1 429 456 1.01e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000188578
SMART Domains Protein: ENSMUSP00000140196
Gene: ENSMUSG00000060962

DomainStartEndE-ValueType
low complexity region 5 102 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
internal_repeat_1 173 200 3.77e-7 PROSPERO
internal_repeat_1 208 235 3.77e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Dmkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Dmkn APN 7 30778270 critical splice donor site probably null
IGL03084:Dmkn APN 7 30771056 missense possibly damaging 0.82
IGL03376:Dmkn APN 7 30771242 missense possibly damaging 0.92
R0077:Dmkn UTSW 7 30765294 missense probably benign 0.00
R0718:Dmkn UTSW 7 30764786 unclassified probably benign
R0892:Dmkn UTSW 7 30767404 missense probably damaging 1.00
R1163:Dmkn UTSW 7 30765051 missense probably damaging 1.00
R1858:Dmkn UTSW 7 30764565 missense probably benign 0.08
R2915:Dmkn UTSW 7 30765316 missense unknown
R4705:Dmkn UTSW 7 30763981 missense probably damaging 1.00
R4806:Dmkn UTSW 7 30771242 missense possibly damaging 0.92
R4921:Dmkn UTSW 7 30771233 missense probably damaging 0.99
R5031:Dmkn UTSW 7 30764236 missense probably benign 0.09
R5056:Dmkn UTSW 7 30764104 missense probably damaging 1.00
R5577:Dmkn UTSW 7 30764546 missense probably damaging 1.00
R5780:Dmkn UTSW 7 30777615 missense probably damaging 1.00
R6233:Dmkn UTSW 7 30779679 missense probably damaging 0.99
R6504:Dmkn UTSW 7 30776429 missense possibly damaging 0.82
R7383:Dmkn UTSW 7 30765368 missense unknown
R7526:Dmkn UTSW 7 30777651 missense possibly damaging 0.90
R7667:Dmkn UTSW 7 30777609 missense probably damaging 1.00
R8790:Dmkn UTSW 7 30764024 missense probably benign 0.33
RF007:Dmkn UTSW 7 30769704 splice site probably null
RF022:Dmkn UTSW 7 30767175 small insertion probably benign
RF027:Dmkn UTSW 7 30767194 small insertion probably benign
RF030:Dmkn UTSW 7 30767182 small insertion probably benign
RF038:Dmkn UTSW 7 30767194 small insertion probably benign
RF041:Dmkn UTSW 7 30767173 small insertion probably benign
RF054:Dmkn UTSW 7 30767188 small insertion probably benign
RF055:Dmkn UTSW 7 30767191 small insertion probably benign
RF056:Dmkn UTSW 7 30767207 small insertion probably benign
RF057:Dmkn UTSW 7 30767188 small insertion probably benign
RF062:Dmkn UTSW 7 30767175 small insertion probably benign
X0067:Dmkn UTSW 7 30778227 missense possibly damaging 0.86
Z1176:Dmkn UTSW 7 30776497 missense possibly damaging 0.82
Z1186:Dmkn UTSW 7 30765393 small deletion probably benign
Z1186:Dmkn UTSW 7 30765401 small deletion probably benign
Z1186:Dmkn UTSW 7 30767171 small insertion probably benign
Z1186:Dmkn UTSW 7 30767174 small insertion probably benign
Z1186:Dmkn UTSW 7 30767177 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTTTCAAAGCCTGGGCCAG -3'
(R):5'- ACATCATTCCCTGGGTTGTTAC -3'

Sequencing Primer
(F):5'- GGCCTGGCCTTCTATTGCTG -3'
(R):5'- CATTCCCTGGGTTGTTACACTGTAG -3'
Posted On2019-12-04