Incidental Mutation 'RF032:Vat1l'
ID604417
Institutional Source Beutler Lab
Gene Symbol Vat1l
Ensembl Gene ENSMUSG00000046844
Gene Namevesicle amine transport protein 1 like
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #RF032 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location114205612-114374071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114289329 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 320 (L320F)
Ref Sequence ENSEMBL: ENSMUSP00000053431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049509]
Predicted Effect probably damaging
Transcript: ENSMUST00000049509
AA Change: L320F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: L320F

DomainStartEndE-ValueType
Pfam:ADH_N 66 142 3.9e-14 PFAM
Pfam:ADH_zinc_N 190 302 1.4e-11 PFAM
Pfam:ADH_zinc_N_2 221 376 1.1e-14 PFAM
low complexity region 389 408 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Vat1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Vat1l APN 8 114369889 missense possibly damaging 0.89
IGL03379:Vat1l APN 8 114282266 missense probably damaging 0.98
R0504:Vat1l UTSW 8 114236579 splice site probably benign
R1222:Vat1l UTSW 8 114282361 splice site probably benign
R1418:Vat1l UTSW 8 114282361 splice site probably benign
R1859:Vat1l UTSW 8 114271301 missense probably damaging 1.00
R3777:Vat1l UTSW 8 114236800 critical splice donor site probably null
R3778:Vat1l UTSW 8 114236800 critical splice donor site probably null
R4154:Vat1l UTSW 8 114205803 missense possibly damaging 0.94
R4158:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4160:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4285:Vat1l UTSW 8 114205783 missense probably damaging 0.97
R4507:Vat1l UTSW 8 114205816 missense probably benign 0.02
R5316:Vat1l UTSW 8 114284348 missense probably damaging 1.00
R6306:Vat1l UTSW 8 114371651 missense probably damaging 1.00
R7031:Vat1l UTSW 8 114271432 missense possibly damaging 0.60
R7162:Vat1l UTSW 8 114236778 missense probably damaging 0.99
R7378:Vat1l UTSW 8 114289392 missense possibly damaging 0.93
R7472:Vat1l UTSW 8 114236799 critical splice donor site probably null
R7662:Vat1l UTSW 8 114282344 missense probably damaging 1.00
RF035:Vat1l UTSW 8 114289329 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236622 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236623 missense probably damaging 1.00
Z1188:Vat1l UTSW 8 114205723 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGACTCTACCTAGTTTCAAACTTTGC -3'
(R):5'- CTGCTCTAGGACTTTTGTTTCAAAC -3'

Sequencing Primer
(F):5'- CAAACTTTGCTTCCCTGGGGTAG -3'
(R):5'- AATCTGGAGAAATAAAAATGGCTTTG -3'
Posted On2019-12-04