Incidental Mutation 'RF032:Nf2'
ID604419
Institutional Source Beutler Lab
Gene Symbol Nf2
Ensembl Gene ENSMUSG00000009073
Gene Nameneurofibromin 2
Synonymsmoesin-ezrin-radixin-like protein, merlin, schwannomin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF032 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location4765845-4849536 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AAAAG to A at 4829936 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053079] [ENSMUST00000056290] [ENSMUST00000109910] [ENSMUST00000164190] [ENSMUST00000172305]
Predicted Effect probably benign
Transcript: ENSMUST00000053079
SMART Domains Protein: ENSMUSP00000055033
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056290
SMART Domains Protein: ENSMUSP00000055061
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 585 6.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109910
SMART Domains Protein: ENSMUSP00000105536
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 222 5.26e-81 SMART
FERM_C 226 315 1.08e-30 SMART
Pfam:ERM 347 596 5.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164190
SMART Domains Protein: ENSMUSP00000129388
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
B41 18 181 1.24e-45 SMART
FERM_C 160 229 1.23e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000172305
SMART Domains Protein: ENSMUSP00000130263
Gene: ENSMUSG00000009073

DomainStartEndE-ValueType
PDB:1H4R|B 1 38 2e-18 PDB
Blast:B41 1 39 1e-18 BLAST
SCOP:d1h4ra3 20 42 2e-4 SMART
low complexity region 86 99 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants lack extraembryonic ectoderm, do not initiate gastrulation and die by embryonic day 7. Heterozygotes develop malignant tumors, especially osteosarcomas. Conditional Schwann cell knockouts resemble neurofibromatosis type 2. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Nf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Nf2 APN 11 4791123 missense probably benign 0.00
IGL01072:Nf2 APN 11 4789713 missense probably null 0.00
IGL01349:Nf2 APN 11 4784472 missense possibly damaging 0.94
IGL01686:Nf2 APN 11 4818613 missense probably benign
IGL01820:Nf2 APN 11 4789655 splice site probably null
IGL02251:Nf2 APN 11 4848873 missense probably null 1.00
IGL02755:Nf2 APN 11 4818542 missense probably damaging 1.00
IGL02859:Nf2 APN 11 4791209 missense probably damaging 1.00
R0331:Nf2 UTSW 11 4794914 missense probably benign 0.21
R0513:Nf2 UTSW 11 4791185 missense possibly damaging 0.56
R0606:Nf2 UTSW 11 4782194 missense possibly damaging 0.90
R0734:Nf2 UTSW 11 4820409 missense probably benign 0.00
R1749:Nf2 UTSW 11 4803694 missense possibly damaging 0.60
R2192:Nf2 UTSW 11 4799899 missense probably damaging 1.00
R4073:Nf2 UTSW 11 4848958 missense probably benign 0.27
R4355:Nf2 UTSW 11 4780613 nonsense probably null
R4629:Nf2 UTSW 11 4848915 missense probably damaging 0.99
R5129:Nf2 UTSW 11 4816145 missense probably benign
R5130:Nf2 UTSW 11 4829862 intron probably benign
R5580:Nf2 UTSW 11 4803689 missense probably damaging 1.00
R5599:Nf2 UTSW 11 4782269 missense probably damaging 1.00
R5840:Nf2 UTSW 11 4816146 missense probably benign 0.24
R6017:Nf2 UTSW 11 4816137 missense possibly damaging 0.95
R6029:Nf2 UTSW 11 4784566 splice site probably null
R6230:Nf2 UTSW 11 4808262 missense possibly damaging 0.81
R6897:Nf2 UTSW 11 4799878 missense probably damaging 1.00
R6990:Nf2 UTSW 11 4799944 missense probably benign 0.09
R7155:Nf2 UTSW 11 4799964 missense probably damaging 0.96
R7826:Nf2 UTSW 11 4789750 missense probably benign 0.35
R8427:Nf2 UTSW 11 4791118 missense probably benign 0.00
R8717:Nf2 UTSW 11 4816099 missense probably damaging 1.00
RF028:Nf2 UTSW 11 4829936 frame shift probably null
RF031:Nf2 UTSW 11 4829936 frame shift probably null
RF033:Nf2 UTSW 11 4829936 frame shift probably null
RF041:Nf2 UTSW 11 4829936 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAGTAATCTTACCAGCCCTG -3'
(R):5'- CATCACACTGCAGCCTGTTA -3'

Sequencing Primer
(F):5'- CTGTTCCTAGTCAAGTCAAGGAGC -3'
(R):5'- CTGCAGCCTGTTAATGGAAC -3'
Posted On2019-12-04