Incidental Mutation 'R0575:Extl1'
ID60442
Institutional Source Beutler Lab
Gene Symbol Extl1
Ensembl Gene ENSMUSG00000028838
Gene Nameexostoses (multiple)-like 1
SynonymsD430033M16Rik
MMRRC Submission 038765-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.513) question?
Stock #R0575 (G1)
Quality Score195
Status Validated
Chromosome4
Chromosomal Location134356372-134383850 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) TGCGTTGCACCGATACCGGG to TG at 134357677 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030643] [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105874]
Predicted Effect probably benign
Transcript: ENSMUST00000030643
SMART Domains Protein: ENSMUSP00000030643
Gene: ENSMUSG00000028838

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Exostosin 87 329 2.1e-38 PFAM
Pfam:Glyco_transf_64 412 652 1.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081094
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105872
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105874
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,591,252 S264N possibly damaging Het
Acsm1 G A 7: 119,659,201 probably null Het
Adsl C T 15: 80,963,685 A93V probably damaging Het
Agbl5 A T 5: 30,894,454 S539C probably damaging Het
Aggf1 T A 13: 95,368,397 T285S probably benign Het
Anapc11 A G 11: 120,599,366 D36G probably benign Het
Ankrd44 G A 1: 54,762,310 A286V probably damaging Het
Atf7ip2 G T 16: 10,237,211 G281C probably damaging Het
Birc6 A G 17: 74,689,237 K4475E probably damaging Het
Ccbe1 T A 18: 66,093,995 probably benign Het
Cyp26b1 A G 6: 84,575,306 probably benign Het
Dcun1d1 T C 3: 35,897,785 probably benign Het
Dtwd2 C A 18: 49,698,472 C156F probably damaging Het
Efcab6 T G 15: 83,967,700 I326L probably benign Het
F5 C A 1: 164,176,244 Q203K probably damaging Het
Frs3 A G 17: 47,703,723 H447R possibly damaging Het
Gmds T G 13: 31,940,583 Q264P probably damaging Het
Golgb1 T A 16: 36,918,809 D2503E probably benign Het
Lgi4 G A 7: 31,060,093 G25R probably benign Het
Olfr10 G A 11: 49,318,053 C169Y probably damaging Het
Olfr1461 T A 19: 13,165,387 Y124* probably null Het
Pcdh20 A G 14: 88,467,612 S751P probably damaging Het
Pcnx4 A G 12: 72,567,236 T652A probably benign Het
Pom121l2 T G 13: 21,984,168 F870V probably damaging Het
Prob1 T C 18: 35,654,721 D160G possibly damaging Het
Spa17 T C 9: 37,603,393 K133E probably damaging Het
Strbp T A 2: 37,640,873 D123V possibly damaging Het
Tnxb A G 17: 34,717,206 T3586A possibly damaging Het
Zfp518a T A 19: 40,912,315 H229Q probably damaging Het
Other mutations in Extl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Extl1 APN 4 134358019 missense probably damaging 1.00
IGL01404:Extl1 APN 4 134359203 missense probably benign 0.06
IGL03040:Extl1 APN 4 134360629 splice site probably benign
R0165:Extl1 UTSW 4 134357703 missense probably damaging 1.00
R0566:Extl1 UTSW 4 134357677 unclassified probably benign
R0941:Extl1 UTSW 4 134357677 unclassified probably benign
R0943:Extl1 UTSW 4 134357677 unclassified probably benign
R0988:Extl1 UTSW 4 134357677 unclassified probably benign
R0989:Extl1 UTSW 4 134357677 unclassified probably benign
R0990:Extl1 UTSW 4 134357677 unclassified probably benign
R1022:Extl1 UTSW 4 134357677 unclassified probably benign
R1035:Extl1 UTSW 4 134357677 unclassified probably benign
R1344:Extl1 UTSW 4 134359241 missense probably damaging 0.99
R1495:Extl1 UTSW 4 134357677 unclassified probably benign
R1699:Extl1 UTSW 4 134364583 nonsense probably null
R1750:Extl1 UTSW 4 134362688 missense probably benign 0.00
R1768:Extl1 UTSW 4 134371138 missense probably benign
R1883:Extl1 UTSW 4 134364606 missense probably benign 0.01
R2143:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2144:Extl1 UTSW 4 134371044 missense probably benign 0.31
R2155:Extl1 UTSW 4 134363180 missense possibly damaging 0.71
R4298:Extl1 UTSW 4 134357658 missense probably damaging 1.00
R4605:Extl1 UTSW 4 134359834 missense probably benign 0.00
R4606:Extl1 UTSW 4 134371379 missense probably damaging 0.99
R4606:Extl1 UTSW 4 134371380 missense probably benign 0.00
R4787:Extl1 UTSW 4 134364667 missense probably damaging 1.00
R5210:Extl1 UTSW 4 134360584 missense probably benign 0.02
R5776:Extl1 UTSW 4 134357772 missense possibly damaging 0.82
R6216:Extl1 UTSW 4 134363130 missense probably benign
R6392:Extl1 UTSW 4 134364634 missense probably benign 0.44
R6674:Extl1 UTSW 4 134358127 missense probably damaging 0.97
R7218:Extl1 UTSW 4 134359769 missense probably benign 0.14
X0020:Extl1 UTSW 4 134358021 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGTGCGAAACGTGCCAAACG -3'
(R):5'- AGGACCATAGCTGATGAGACTCCCAC -3'

Sequencing Primer
(F):5'- CGTGCCAAACGCAACCC -3'
(R):5'- GATGAACTTCCTGGTAGCCAC -3'
Posted On2013-07-11