Incidental Mutation 'RF032:Cluh'
ID604420
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #RF032 (G1)
Quality Score218.659
Status Not validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) CCCGAGCC to CCCGAGCCCGAGCC at 74669515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000092915] [ENSMUST00000102520] [ENSMUST00000117818]
Predicted Effect probably benign
Transcript: ENSMUST00000021091
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092915
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102520
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117818
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 splice site probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
R7086:Cluh UTSW 11 74667340 missense possibly damaging 0.46
R7225:Cluh UTSW 11 74666406 splice site probably null
R7310:Cluh UTSW 11 74669459 missense probably benign 0.10
R7317:Cluh UTSW 11 74665704 missense possibly damaging 0.90
R7674:Cluh UTSW 11 74667720 missense probably damaging 1.00
R7941:Cluh UTSW 11 74659757 missense probably benign 0.00
RF020:Cluh UTSW 11 74669538 small insertion probably benign
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Z1177:Cluh UTSW 11 74667754 missense possibly damaging 0.82
Z1186:Cluh UTSW 11 74669517 small insertion probably benign
Z1186:Cluh UTSW 11 74669531 small insertion probably benign
Z1187:Cluh UTSW 11 74669514 small insertion probably benign
Z1187:Cluh UTSW 11 74669516 small insertion probably benign
Z1187:Cluh UTSW 11 74669517 small insertion probably benign
Z1187:Cluh UTSW 11 74669520 small insertion probably benign
Z1187:Cluh UTSW 11 74669521 small insertion probably benign
Z1187:Cluh UTSW 11 74669524 small insertion probably benign
Z1187:Cluh UTSW 11 74669529 small insertion probably benign
Z1188:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669514 frame shift probably null
Z1189:Cluh UTSW 11 74669517 small insertion probably benign
Z1189:Cluh UTSW 11 74669519 small insertion probably benign
Z1189:Cluh UTSW 11 74669523 small insertion probably benign
Z1189:Cluh UTSW 11 74669529 small insertion probably benign
Z1189:Cluh UTSW 11 74669530 nonsense probably null
Z1189:Cluh UTSW 11 74669531 small insertion probably benign
Z1190:Cluh UTSW 11 74669517 small insertion probably benign
Z1190:Cluh UTSW 11 74669518 small insertion probably benign
Z1190:Cluh UTSW 11 74669530 small insertion probably benign
Z1190:Cluh UTSW 11 74669532 small insertion probably benign
Z1191:Cluh UTSW 11 74669514 small insertion probably benign
Z1191:Cluh UTSW 11 74669517 small insertion probably benign
Z1191:Cluh UTSW 11 74669523 small insertion probably benign
Z1191:Cluh UTSW 11 74669526 small insertion probably benign
Z1191:Cluh UTSW 11 74669530 small insertion probably benign
Z1192:Cluh UTSW 11 74669517 small insertion probably benign
Z1192:Cluh UTSW 11 74669525 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGTGTAGTCAGCACTCC -3'
(R):5'- CCCCAGAATTCTCCTGGAATCTG -3'

Sequencing Primer
(F):5'- AGGAGTGCCCGTTCATACATC -3'
(R):5'- AATCTGTCTGCATCGCCGG -3'
Posted On2019-12-04