Incidental Mutation 'RF032:H2-T10'
ID604424
Institutional Source Beutler Lab
Gene Symbol H2-T10
Ensembl Gene ENSMUSG00000079491
Gene Namehistocompatibility 2, T region locus 10
SynonymsH-2T10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #RF032 (G1)
Quality Score214.458
Status Not validated
Chromosome17
Chromosomal Location36115876-36121465 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTTCCCACTGTA to T at 36120294 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046131] [ENSMUST00000166442] [ENSMUST00000173128] [ENSMUST00000174382]
Predicted Effect probably benign
Transcript: ENSMUST00000046131
SMART Domains Protein: ENSMUSP00000040558
Gene: ENSMUSG00000092243

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 2.3e-81 PFAM
IGc1 220 285 8.12e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166442
SMART Domains Protein: ENSMUSP00000127602
Gene: ENSMUSG00000079491

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 191 6.2e-49 PFAM
IGc1 210 281 4.18e-24 SMART
transmembrane domain 294 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173128
SMART Domains Protein: ENSMUSP00000134339
Gene: ENSMUSG00000092277

DomainStartEndE-ValueType
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174382
SMART Domains Protein: ENSMUSP00000133893
Gene: ENSMUSG00000079491

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:MHC_I 29 205 9.5e-47 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in H2-T10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:H2-T10 APN 17 36120710 missense probably benign 0.08
IGL01946:H2-T10 APN 17 36120716 missense possibly damaging 0.45
IGL03367:H2-T10 APN 17 36120393 missense possibly damaging 0.81
IGL03381:H2-T10 APN 17 36119354 missense probably benign
IGL03381:H2-T10 APN 17 36119357 nonsense probably null
FR4304:H2-T10 UTSW 17 36120281 frame shift probably null
R0305:H2-T10 UTSW 17 36119368 missense probably damaging 1.00
R1446:H2-T10 UTSW 17 36119374 missense possibly damaging 0.87
R1483:H2-T10 UTSW 17 36121146 missense probably benign 0.44
R2038:H2-T10 UTSW 17 36119425 missense probably benign 0.00
R2402:H2-T10 UTSW 17 36117739 splice site probably null
R4755:H2-T10 UTSW 17 36118945 nonsense probably null
R4957:H2-T10 UTSW 17 36117416 utr 3 prime probably benign
R5162:H2-T10 UTSW 17 36118951 splice site probably null
R5568:H2-T10 UTSW 17 36119187 critical splice donor site probably null
R6226:H2-T10 UTSW 17 36121083 missense probably damaging 0.99
R6850:H2-T10 UTSW 17 36119260 missense probably damaging 1.00
R7249:H2-T10 UTSW 17 36119377 missense probably damaging 0.99
R7324:H2-T10 UTSW 17 36119297 missense probably damaging 1.00
R7466:H2-T10 UTSW 17 36120849 missense probably benign 0.10
R7679:H2-T10 UTSW 17 36119324 missense not run
R7767:H2-T10 UTSW 17 36117730 missense probably benign 0.02
R7901:H2-T10 UTSW 17 36120251 missense probably benign
R8278:H2-T10 UTSW 17 36118940 missense probably benign 0.00
R8315:H2-T10 UTSW 17 36119013 missense probably benign 0.41
RF046:H2-T10 UTSW 17 36120294 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGAGCCTCTTGCCTCTCTG -3'
(R):5'- GGACTGACCACCAACTATGTC -3'

Sequencing Primer
(F):5'- GGATCTAAACCAGAACTCGTGCTTG -3'
(R):5'- GACCACCAACTATGTCCTTCCTAG -3'
Posted On2019-12-04