Incidental Mutation 'RF032:Calhm1'
ID604426
Institutional Source Beutler Lab
Gene Symbol Calhm1
Ensembl Gene ENSMUSG00000079258
Gene Namecalcium homeostasis modulator 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF032 (G1)
Quality Score217.468
Status Not validated
Chromosome19
Chromosomal Location47141035-47144174 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) C to CTGTGGCCGTGG at 47141283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035822] [ENSMUST00000111813] [ENSMUST00000140512]
Predicted Effect probably benign
Transcript: ENSMUST00000035822
SMART Domains Protein: ENSMUSP00000047278
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 256 2.3e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111813
SMART Domains Protein: ENSMUSP00000107444
Gene: ENSMUSG00000079258

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 255 5.6e-94 PFAM
low complexity region 267 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140512
SMART Domains Protein: ENSMUSP00000121661
Gene: ENSMUSG00000033033

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 6 258 2.9e-93 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered cortical neuron electrical properties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Smpx CCCCCCA C X: 157,720,923 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Calhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:Calhm1 UTSW 19 47141251 unclassified probably benign
FR4449:Calhm1 UTSW 19 47141274 unclassified probably benign
FR4976:Calhm1 UTSW 19 47141262 unclassified probably benign
R0328:Calhm1 UTSW 19 47141303 missense possibly damaging 0.46
R0402:Calhm1 UTSW 19 47141457 missense probably damaging 0.98
R0463:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R0608:Calhm1 UTSW 19 47143841 missense probably benign 0.16
R1552:Calhm1 UTSW 19 47141201 missense probably benign 0.00
R4647:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R4648:Calhm1 UTSW 19 47143801 missense probably damaging 0.98
R5762:Calhm1 UTSW 19 47143619 splice site probably null
R5766:Calhm1 UTSW 19 47143703 missense probably benign 0.00
RF001:Calhm1 UTSW 19 47141276 unclassified probably benign
RF010:Calhm1 UTSW 19 47141273 unclassified probably benign
RF014:Calhm1 UTSW 19 47141265 unclassified probably benign
RF015:Calhm1 UTSW 19 47141256 unclassified probably benign
RF023:Calhm1 UTSW 19 47141273 unclassified probably benign
RF025:Calhm1 UTSW 19 47141276 unclassified probably benign
RF025:Calhm1 UTSW 19 47141277 unclassified probably benign
RF030:Calhm1 UTSW 19 47141253 unclassified probably benign
RF035:Calhm1 UTSW 19 47141253 unclassified probably benign
RF036:Calhm1 UTSW 19 47141277 unclassified probably benign
RF040:Calhm1 UTSW 19 47141277 unclassified probably benign
RF050:Calhm1 UTSW 19 47141270 unclassified probably benign
RF057:Calhm1 UTSW 19 47141270 unclassified probably benign
RF063:Calhm1 UTSW 19 47141256 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTCATCAGTGGTGCCTC -3'
(R):5'- TGACCACATTACTAGCGTTCG -3'

Sequencing Primer
(F):5'- ATTCATGGTGCCTTGGTC -3'
(R):5'- CACATTACTAGCGTTCGTGGTACG -3'
Posted On2019-12-04