Incidental Mutation 'RF032:Smpx'
ID604428
Institutional Source Beutler Lab
Gene Symbol Smpx
Ensembl Gene ENSMUSG00000041476
Gene Namesmall muscle protein, X-linked
Synonymschisel, 1010001C09Rik, Csl
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF032 (G1)
Quality Score209.458
Status Not validated
ChromosomeX
Chromosomal Location157698910-157752591 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) CCCCCCA to C at 157720923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038007] [ENSMUST00000112520] [ENSMUST00000112521] [ENSMUST00000147283] [ENSMUST00000190091]
Predicted Effect probably benign
Transcript: ENSMUST00000038007
SMART Domains Protein: ENSMUSP00000048522
Gene: ENSMUSG00000041476

DomainStartEndE-ValueType
Pfam:Chisel 1 85 5.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112520
SMART Domains Protein: ENSMUSP00000108139
Gene: ENSMUSG00000041476

DomainStartEndE-ValueType
Pfam:Chisel 1 85 5.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112521
SMART Domains Protein: ENSMUSP00000108140
Gene: ENSMUSG00000041476

DomainStartEndE-ValueType
Pfam:Chisel 1 84 5.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147283
Predicted Effect probably benign
Transcript: ENSMUST00000190091
SMART Domains Protein: ENSMUSP00000140268
Gene: ENSMUSG00000041476

DomainStartEndE-ValueType
Pfam:Chisel 1 85 5.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small protein that has no known functional domains. Mutations in this gene are a cause of X-linked deafness-4, and the encoded protein may play a role in the maintenance of inner ear cells subjected to mechanical stress. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation do not exhibit defects in heart or skeletal muscle morphology or development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 TACCT TACCTGACCT 17: 24,287,727 probably null Het
Acap3 CTGCTG CTGCTGCATCCTGGGATGCTG 4: 155,905,102 probably benign Het
Arid1b GCG GCGTCG 17: 4,995,588 probably benign Het
Blm CTCC CTCCTCCTCCTCGTCC 7: 80,512,930 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,063 probably null Het
Calhm1 C CTGTGGCCGTGG 19: 47,141,283 probably null Het
Cluh CCCGAGCC CCCGAGCCCGAGCC 11: 74,669,515 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATGTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dmkn GT GTTGTGAAAGTGGTGGAAGTGGTGGAATT 7: 30,767,182 probably benign Het
Efhd2 CGCC CGCCGCAGCC 4: 141,874,772 probably benign Het
Enah TGGCGGTGG TG 1: 181,921,929 probably null Het
Gm8369 GTGTGT GTGTGTATGTGT 19: 11,511,778 probably benign Het
H2-T10 TTTCCCACTGTA T 17: 36,120,294 probably null Het
Ifi207 GCCTGAGCTGTGGAAGTCTCCCCCTGAGCTGTGGAAGTCTC GCCTGAGCTGTGGAAGTCTC 1: 173,735,157 probably benign Het
Igf1r GATGGAGC GATGGAGCTGGATATGGAGC 7: 68,226,179 probably benign Het
Krtap28-10 AGCCACAGCCACCACAGCCACAGCCACCAC AGCCACAGCCACCACCGCCACAGCCACCACAGCCACAGCCACCAC 1: 83,042,258 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l AGC AGCGGC 3: 59,275,985 probably benign Het
Med12l GCA GCACCA 3: 59,275,989 probably benign Het
Mn1 CAG CAGAAG 5: 111,419,711 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 TTAGCAGTGAGGAGCAAGCTGAGA TTAGCAGTGAGGAGCAAGCTGAGATACACGGTAGCAGTGAGGAGCAAGCTGAGA 2: 119,627,587 probably benign Het
Olfr418 GTGACATC G 1: 173,270,709 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Pik3c2g G GGAGA 6: 139,635,658 probably null Het
Pou3f1 GGCGGCCG GGCGGCCGCGGCCG 4: 124,657,805 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Reep1 CC CCCGAC 6: 71,707,968 probably null Het
Slc12a1 ACAAACC ACAAACCTTTGGCCACCAAACC 2: 125,154,210 probably benign Het
Spaca1 TCGC TCGCTCACGC 4: 34,049,854 probably benign Het
Supt20 GCAGCA GCAGCACCAGCA 3: 54,727,666 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCTCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tgoln1 T TCACCTCCCGTGGGCTTGCCAGAAG 6: 72,616,074 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG CCCCAGGACTCCCTGTGCCCAACGGAACAATCCCAGGACTCCCTGTGCCCAACGGGACAATCCCAGG 15: 78,967,036 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Zfhx3 CAGCAACAG CAGCAACAGAAGCAACAG 8: 108,956,092 probably benign Het
Other mutations in Smpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Smpx APN X 157714680 splice site probably benign
IGL03221:Smpx APN X 157720998 missense probably damaging 0.96
FR4976:Smpx UTSW X 157720924 critical splice acceptor site probably benign
X0062:Smpx UTSW X 157720995 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAACTCTAAGGCTGTCTGAAC -3'
(R):5'- GCAGGCTAAATTGAACATCTCTG -3'

Sequencing Primer
(F):5'- TCTAAGGCTGTCTGAACACTAAC -3'
(R):5'- GGCTAAATTGAACATCTCTGGTAGAG -3'
Posted On2019-12-04