Incidental Mutation 'RF033:Rbm12'
ID604434
Institutional Source Beutler Lab
Gene Symbol Rbm12
Ensembl Gene ENSMUSG00000089824
Gene NameRNA binding motif protein 12
SynonymsSWAN, 5730420G12Rik, 9430070C08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #RF033 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location156091958-156111978 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GTATTG to GTATTGTGGGACCAGGTATTGCGGGACCAGGTATTG at 156096079 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059647] [ENSMUST00000079312] [ENSMUST00000109604] [ENSMUST00000109607] [ENSMUST00000109608] [ENSMUST00000128499] [ENSMUST00000131377] [ENSMUST00000132494] [ENSMUST00000133921] [ENSMUST00000136296] [ENSMUST00000138068] [ENSMUST00000142960] [ENSMUST00000147627] [ENSMUST00000153634] [ENSMUST00000154889] [ENSMUST00000183518] [ENSMUST00000183972] [ENSMUST00000184152] [ENSMUST00000184265] [ENSMUST00000184899]
Predicted Effect probably benign
Transcript: ENSMUST00000059647
SMART Domains Protein: ENSMUSP00000050461
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079312
SMART Domains Protein: ENSMUSP00000078292
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 468 8.96e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109604
SMART Domains Protein: ENSMUSP00000105233
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.1e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
low complexity region 655 767 N/A INTRINSIC
low complexity region 781 812 N/A INTRINSIC
low complexity region 866 908 N/A INTRINSIC
RRM 917 990 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109607
SMART Domains Protein: ENSMUSP00000105236
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109608
SMART Domains Protein: ENSMUSP00000105237
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
VWA 282 484 9.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127956
SMART Domains Protein: ENSMUSP00000114923
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
low complexity region 10 28 N/A INTRINSIC
low complexity region 73 172 N/A INTRINSIC
RRM 217 287 1.05e-1 SMART
RRM 343 415 2.73e-7 SMART
RRM 457 529 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128499
SMART Domains Protein: ENSMUSP00000118067
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 6e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131377
SMART Domains Protein: ENSMUSP00000120731
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 1e-7 PDB
Blast:RRM_2 4 72 4e-29 BLAST
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132494
SMART Domains Protein: ENSMUSP00000139175
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Pfam:RRM_6 5 70 1.5e-5 PFAM
low complexity region 98 116 N/A INTRINSIC
low complexity region 161 260 N/A INTRINSIC
RRM 305 375 1.05e-1 SMART
RRM 431 503 2.73e-7 SMART
RRM 545 617 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133921
SMART Domains Protein: ENSMUSP00000122644
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Pfam:C2 139 178 3.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136296
SMART Domains Protein: ENSMUSP00000122994
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 378 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138068
SMART Domains Protein: ENSMUSP00000119519
Gene: ENSMUSG00000089824

DomainStartEndE-ValueType
PDB:2DB1|A 2 86 5e-8 PDB
Blast:RRM_2 4 72 1e-30 BLAST
low complexity region 98 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142960
SMART Domains Protein: ENSMUSP00000121299
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 2.4e-11 SMART
C2 123 206 3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147627
SMART Domains Protein: ENSMUSP00000116982
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 137 242 8.76e-12 SMART
Pfam:Copine 303 350 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153634
SMART Domains Protein: ENSMUSP00000115167
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
C2 123 218 7.88e-5 SMART
Pfam:Copine 279 325 4.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154889
SMART Domains Protein: ENSMUSP00000118140
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159952
SMART Domains Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 2e-15 SMART
PDB:1P3W|A 3 86 3e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 160 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160165
SMART Domains Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
PDB:1P3W|A 3 28 1e-6 PDB
low complexity region 36 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162612
SMART Domains Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
SCOP:d1eg5a_ 3 82 1e-15 SMART
PDB:1P3W|A 3 86 2e-34 PDB
low complexity region 93 106 N/A INTRINSIC
Blast:RRM_2 124 161 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183518
SMART Domains Protein: ENSMUSP00000139010
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 40 4e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183972
Predicted Effect probably benign
Transcript: ENSMUST00000184152
SMART Domains Protein: ENSMUSP00000139035
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184265
SMART Domains Protein: ENSMUSP00000138888
Gene: ENSMUSG00000074643

DomainStartEndE-ValueType
C2 6 112 3.64e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184899
SMART Domains Protein: ENSMUSP00000139177
Gene: ENSMUSG00000098950

DomainStartEndE-ValueType
Blast:RRM_2 4 54 2e-25 BLAST
SCOP:d2u1a__ 9 68 6e-3 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 2 H2. Two alternatively spliced transcript variants have been identified for this gene. Both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit open neural tube and embryonic growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Arid1b GGGG GGGGGGG 17: 4,995,585 probably benign Het
AY761185 CCCGGGCACT C 8: 20,943,888 probably benign Het
Chga AGC AGCTGC 12: 102,561,396 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fbrsl1 GTG GTGAGTGTGCTGATG 5: 110,378,125 probably benign Het
Gab3 TTC TTCGTC X: 75,000,001 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Gm47955 TGG TGGTTGTGGCGG 1: 82,960,525 probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,144 probably null Het
Gm8369 GTGTGT GTGTGTCTGTGT 19: 11,511,778 probably benign Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 GG GGGCTTGGAGTGTG 3: 37,125,842 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTTCAGCTCCAGCT 2: 181,697,588 probably benign Het
Luzp1 A AGGTGTCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCGAGCTCCAGCTCCAGCTCCA 2: 121,306,299 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l CAG CAGAAG 3: 59,275,987 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nefh GGGGACTTG GGGGACTTGTCCTCACCTGGGACTTG 11: 4,941,029 probably null Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 GCAAGCTGAGA GCAAGCTGAGATACACGTTAGCAGTGAGGTTCAAGCTGAGA 2: 119,627,600 probably benign Het
P4ha3 GGGGG GGGGGG 7: 100,310,810 probably null Het
Pdia4 ATCCTCTTCCTC ATC 6: 47,808,288 probably benign Het
Pkhd1l1 TTT TTTTTTTTTTCTT 15: 44,558,506 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Thegl ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,405 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAC 5: 77,016,429 probably benign Het
Tmem28 CG CGCCGCTG X: 99,821,373 probably benign Het
Tmem59 TGTTT TGTTTGTTGGTTT 4: 107,190,528 probably benign Het
Other mutations in Rbm12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Rbm12 APN 2 156096041 intron probably benign
IGL01307:Rbm12 APN 2 156095382 intron probably benign
IGL02474:Rbm12 APN 2 156098097 missense probably damaging 1.00
IGL02596:Rbm12 APN 2 156095560 intron probably benign
IGL02601:Rbm12 APN 2 156095560 intron probably benign
IGL02603:Rbm12 APN 2 156095560 intron probably benign
IGL02608:Rbm12 APN 2 156095898 intron probably benign
IGL02679:Rbm12 APN 2 156095560 intron probably benign
IGL02691:Rbm12 APN 2 156095560 intron probably benign
IGL02693:Rbm12 APN 2 156095560 intron probably benign
IGL02702:Rbm12 APN 2 156095560 intron probably benign
IGL02703:Rbm12 APN 2 156095560 intron probably benign
IGL03407:Rbm12 APN 2 156097564 nonsense probably null
IGL02991:Rbm12 UTSW 2 156095560 intron probably benign
R0310:Rbm12 UTSW 2 156095724 intron probably benign
R1213:Rbm12 UTSW 2 156097492 nonsense probably null
R1280:Rbm12 UTSW 2 156096829 missense probably damaging 1.00
R1511:Rbm12 UTSW 2 156097536 missense probably damaging 0.98
R1951:Rbm12 UTSW 2 156097213 missense probably damaging 0.99
R2131:Rbm12 UTSW 2 156095510 nonsense probably null
R2133:Rbm12 UTSW 2 156095510 nonsense probably null
R2883:Rbm12 UTSW 2 156097075 missense probably damaging 0.98
R4760:Rbm12 UTSW 2 156097128 missense probably damaging 0.99
R4783:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4784:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4785:Rbm12 UTSW 2 156096564 missense possibly damaging 0.95
R4794:Rbm12 UTSW 2 156095569 intron probably benign
R5057:Rbm12 UTSW 2 156096886 missense probably benign 0.18
R5383:Rbm12 UTSW 2 156103365 utr 5 prime probably benign
R5599:Rbm12 UTSW 2 156096793 nonsense probably null
R5979:Rbm12 UTSW 2 156097759 intron probably benign
R6083:Rbm12 UTSW 2 156097726 intron probably benign
R6769:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R6771:Rbm12 UTSW 2 156097455 missense possibly damaging 0.95
R7233:Rbm12 UTSW 2 156095974 missense unknown
R7424:Rbm12 UTSW 2 156097303 missense possibly damaging 0.57
R7483:Rbm12 UTSW 2 156098218 missense unknown
R7643:Rbm12 UTSW 2 156098217 missense unknown
R7848:Rbm12 UTSW 2 156096216 missense probably benign 0.01
R7931:Rbm12 UTSW 2 156096216 missense probably benign 0.01
RF001:Rbm12 UTSW 2 156096075 intron probably benign
RF021:Rbm12 UTSW 2 156096106 intron probably benign
RF028:Rbm12 UTSW 2 156096130 frame shift probably null
RF029:Rbm12 UTSW 2 156096095 intron probably benign
RF033:Rbm12 UTSW 2 156096080 intron probably benign
RF033:Rbm12 UTSW 2 156096082 intron probably benign
RF033:Rbm12 UTSW 2 156096083 intron probably benign
RF033:Rbm12 UTSW 2 156096084 intron probably benign
RF038:Rbm12 UTSW 2 156096106 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTGCACCTCCAAAACC -3'
(R):5'- AATACCTGGTCCCGCAATGC -3'

Sequencing Primer
(F):5'- TGGAACTTCCAGTCCTAGGC -3'
(R):5'- AATGCCTGGTCCTGCAATG -3'
Posted On2019-12-04