Incidental Mutation 'RF033:Thegl'
ID604449
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #RF033 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationsmall insertion (9 aa in frame mutation)
DNA Base Change (assembly) G to GCGATCCTCCCCAGTCCCGCAAGGCCAC at 77016429 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Arid1b GGGG GGGGGGG 17: 4,995,585 probably benign Het
AY761185 CCCGGGCACT C 8: 20,943,888 probably benign Het
Chga AGC AGCTGC 12: 102,561,396 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fbrsl1 GTG GTGAGTGTGCTGATG 5: 110,378,125 probably benign Het
Gab3 TTC TTCGTC X: 75,000,001 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Gm47955 TGG TGGTTGTGGCGG 1: 82,960,525 probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,144 probably null Het
Gm8369 GTGTGT GTGTGTCTGTGT 19: 11,511,778 probably benign Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 GG GGGCTTGGAGTGTG 3: 37,125,842 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTTCAGCTCCAGCT 2: 181,697,588 probably benign Het
Luzp1 A AGGTGTCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCGAGCTCCAGCTCCAGCTCCA 2: 121,306,299 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l CAG CAGAAG 3: 59,275,987 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nefh GGGGACTTG GGGGACTTGTCCTCACCTGGGACTTG 11: 4,941,029 probably null Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 GCAAGCTGAGA GCAAGCTGAGATACACGTTAGCAGTGAGGTTCAAGCTGAGA 2: 119,627,600 probably benign Het
P4ha3 GGGGG GGGGGG 7: 100,310,810 probably null Het
Pdia4 ATCCTCTTCCTC ATC 6: 47,808,288 probably benign Het
Pkhd1l1 TTT TTTTTTTTTTCTT 15: 44,558,506 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 GTATTG GTATTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,079 probably benign Het
Rbm12 TATTG TATTGTGGGACCAGGTATTGCGGGACCAGGCATTG 2: 156,096,080 probably benign Het
Rbm12 TTG TTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,082 probably benign Het
Rbm12 TG TGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,083 probably benign Het
Rbm12 G GTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,084 probably benign Het
Tmem28 CG CGCCGCTG X: 99,821,373 probably benign Het
Tmem59 TGTTT TGTTTGTTGGTTT 4: 107,190,528 probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGGTTCATCCGTGCGATC -3'
(R):5'- CCGTGGTAGGTATCTGGCTATC -3'

Sequencing Primer
(F):5'- TTCATCCGTGCGATCCGAGG -3'
(R):5'- TAGGTATCTGGCTATCAAAGATGG -3'
Posted On2019-12-04