Incidental Mutation 'RF033:Gm8369'
ID604467
Institutional Source Beutler Lab
Gene Symbol Gm8369
Ensembl Gene ENSMUSG00000058470
Gene Namepredicted gene 8369
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #RF033 (G1)
Quality Score217.468
Status Not validated
Chromosome19
Chromosomal Location11485938-11512577 bp(+) (GRCm38)
Type of Mutationsmall insertion (2 aa in frame mutation)
DNA Base Change (assembly) GTGTGT to GTGTGTCTGTGT at 11511778 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079855] [ENSMUST00000163078] [ENSMUST00000186423] [ENSMUST00000188633]
Predicted Effect probably benign
Transcript: ENSMUST00000079855
SMART Domains Protein: ENSMUSP00000132521
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 130 145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163078
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186423
SMART Domains Protein: ENSMUSP00000140897
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 1 62 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188633
SMART Domains Protein: ENSMUSP00000141067
Gene: ENSMUSG00000058470

DomainStartEndE-ValueType
Pfam:CD20 2 48 3.7e-9 PFAM
low complexity region 130 145 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGTCG 19: 5,425,224 probably benign Het
AI837181 CG CGGTG 19: 5,425,237 probably benign Het
Arid1b GGGG GGGGGGG 17: 4,995,585 probably benign Het
AY761185 CCCGGGCACT C 8: 20,943,888 probably benign Het
Chga AGC AGCTGC 12: 102,561,396 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dbr1 GAGGAG GAGGAGTAGGAG 9: 99,583,697 probably null Het
Dcdc2b GCTGC GCTGCCAGGCCTGC 4: 129,609,651 probably benign Het
E4f1 AGGC AGGCGGC 17: 24,455,183 probably benign Het
Fam45a ACTC ACTCCTC 19: 60,814,618 probably benign Het
Fbrsl1 GTG GTGAGTGTGCTGATG 5: 110,378,125 probably benign Het
Gab3 TTC TTCGTC X: 75,000,001 probably benign Het
Gab3 TCT TCTGCT X: 75,000,023 probably benign Het
Gm47955 TGG TGGTTGTGGCGG 1: 82,960,525 probably benign Het
Gm5475 GAAAGGTGGAAGGAAA GAA 15: 100,427,144 probably null Het
Heatr3 TTAT TTATGTAT 8: 88,156,456 probably benign Het
Il2 AGGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTGCTG 3: 37,125,764 probably benign Het
Il2 GG GGGCTTGGAGTGTG 3: 37,125,842 probably benign Het
Lkaaear1 CCAGCTCCAGCT CCAGCTCCAGCTTCAGCTCCAGCT 2: 181,697,588 probably benign Het
Luzp1 A AGGTGTCCTCTTCAGC 4: 136,543,196 probably benign Het
Mamld1 GCA GCATCA X: 71,118,833 probably benign Het
Map1a CAGCTCCAGCTCCAGCTCCA CAGCTCCAGCTCCAGCTCCAGCTCCAGCTCGAGCTCCAGCTCCAGCTCCA 2: 121,306,299 probably benign Het
Med12l CAG CAGAAG 3: 59,275,981 probably benign Het
Med12l CAG CAGAAG 3: 59,275,987 probably benign Het
Med12l GC GCATC 3: 59,275,995 probably benign Het
Ncoa6 TGCAGC TGC 2: 155,421,731 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGACTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nefh GGGGACTTG GGGGACTTGTCCTCACCTGGGACTTG 11: 4,941,029 probably null Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nusap1 GCAAGCTGAGA GCAAGCTGAGATACACGTTAGCAGTGAGGTTCAAGCTGAGA 2: 119,627,600 probably benign Het
P4ha3 GGGGG GGGGGG 7: 100,310,810 probably null Het
Pdia4 ATCCTCTTCCTC ATC 6: 47,808,288 probably benign Het
Pkhd1l1 TTT TTTTTTTTTTCTT 15: 44,558,506 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rbm12 GTATTG GTATTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,079 probably benign Het
Rbm12 TATTG TATTGTGGGACCAGGTATTGCGGGACCAGGCATTG 2: 156,096,080 probably benign Het
Rbm12 TTG TTGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,082 probably benign Het
Rbm12 TG TGTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,083 probably benign Het
Rbm12 G GTGGGACCAGGTATTGCGGGACCAGGTATTG 2: 156,096,084 probably benign Het
Thegl ATCCTCCCCAGTCCCGCAAGGCCAG ATCCTCCCCAGTCCCGCAAGGCCAGCGCTCCTCCCCAGTCCCGCAAGGCCAG 5: 77,016,405 probably benign Het
Thegl G GCGATCCTCCCCAGTCCCGCAAGGCCAC 5: 77,016,429 probably benign Het
Tmem28 CG CGCCGCTG X: 99,821,373 probably benign Het
Tmem59 TGTTT TGTTTGTTGGTTT 4: 107,190,528 probably benign Het
Other mutations in Gm8369
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1013:Gm8369 UTSW 19 11511783 frame shift probably null
R4192:Gm8369 UTSW 19 11502232 missense probably damaging 0.97
R5445:Gm8369 UTSW 19 11504806 missense possibly damaging 0.55
R5809:Gm8369 UTSW 19 11504884 intron probably benign
R6258:Gm8369 UTSW 19 11511609 missense possibly damaging 0.93
R6791:Gm8369 UTSW 19 11511836 unclassified probably benign
RF004:Gm8369 UTSW 19 11511754 small insertion probably benign
RF006:Gm8369 UTSW 19 11511764 small insertion probably benign
RF008:Gm8369 UTSW 19 11511754 frame shift probably null
RF016:Gm8369 UTSW 19 11511754 frame shift probably null
RF017:Gm8369 UTSW 19 11511742 frame shift probably null
RF018:Gm8369 UTSW 19 11511742 frame shift probably null
RF025:Gm8369 UTSW 19 11511773 frame shift probably null
RF028:Gm8369 UTSW 19 11511773 nonsense probably null
RF032:Gm8369 UTSW 19 11511778 small insertion probably benign
RF035:Gm8369 UTSW 19 11511773 small insertion probably benign
RF036:Gm8369 UTSW 19 11511778 small insertion probably benign
RF037:Gm8369 UTSW 19 11511782 small insertion probably benign
RF039:Gm8369 UTSW 19 11511758 small insertion probably benign
RF039:Gm8369 UTSW 19 11511782 small insertion probably benign
RF041:Gm8369 UTSW 19 11511758 small insertion probably benign
RF042:Gm8369 UTSW 19 11511773 frame shift probably null
RF042:Gm8369 UTSW 19 11511778 small insertion probably benign
RF054:Gm8369 UTSW 19 11511764 frame shift probably null
RF055:Gm8369 UTSW 19 11511748 frame shift probably null
Z1176:Gm8369 UTSW 19 11511624 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACCAAATCCTGCTGTGAC -3'
(R):5'- ACCTCACTTCACTAACATAGGTG -3'

Sequencing Primer
(F):5'- CCAAATCCTGCTGTGACAGTGATG -3'
(R):5'- GTTTGGTCAATTTGCATTCAAACTTC -3'
Posted On2019-12-04