Incidental Mutation 'RF034:A030005L19Rik'
Institutional Source Beutler Lab
Gene Symbol A030005L19Rik
Ensembl Gene ENSMUSG00000113880
Gene NameRIKEN cDNA A030005L19 gene
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF034 (G1)
Quality Score217.002
Status Not validated
Chromosomal Location82913325-82914130 bp(+) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) TGTGGCTGC to TGTGGCTGCGGTGGCTGC at 82913580 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152156 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000220768
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Defb22 TGCGGCA TGCGGCAGGGCTGGCCTTTGCGGCA 2: 152,485,832 probably benign Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in A030005L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
RF001:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF005:A030005L19Rik UTSW 1 82913585 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF011:A030005L19Rik UTSW 1 82913586 small insertion probably benign
RF016:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF018:A030005L19Rik UTSW 1 82913572 small insertion probably benign
RF021:A030005L19Rik UTSW 1 82913569 small insertion probably benign
RF023:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF028:A030005L19Rik UTSW 1 82913578 small insertion probably benign
RF028:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF035:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF038:A030005L19Rik UTSW 1 82913580 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913577 small insertion probably benign
RF040:A030005L19Rik UTSW 1 82913590 small insertion probably benign
RF042:A030005L19Rik UTSW 1 82913584 small insertion probably benign
RF044:A030005L19Rik UTSW 1 82913589 small insertion probably benign
RF053:A030005L19Rik UTSW 1 82913573 small insertion probably benign
RF059:A030005L19Rik UTSW 1 82913579 small insertion probably benign
RF060:A030005L19Rik UTSW 1 82913396 small deletion probably benign
RF060:A030005L19Rik UTSW 1 82913579 nonsense probably null
RF060:A030005L19Rik UTSW 1 82913587 small insertion probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-12-04