Incidental Mutation 'RF034:Defb22'
ID604477
Institutional Source Beutler Lab
Gene Symbol Defb22
Ensembl Gene ENSMUSG00000027468
Gene Namedefensin beta 22
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF034 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location152485663-152490138 bp(-) (GRCm38)
Type of Mutationsmall insertion (6 aa in frame mutation)
DNA Base Change (assembly) TGCGGCA to TGCGGCAGGGCTGGCCTTTGCGGCA at 152485832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028966]
Predicted Effect probably benign
Transcript: ENSMUST00000028966
SMART Domains Protein: ENSMUSP00000028966
Gene: ENSMUSG00000027468

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Defensin_beta_2 26 59 4e-11 PFAM
low complexity region 89 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T TTATTATGATTATTAC 3: 37,050,760 probably benign Het
A030005L19Rik TGTGGCTGC TGTGGCTGCGGTGGCTGC 1: 82,913,580 probably benign Het
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTACATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Alpk3 GAGAAGGCAC G 7: 81,092,414 probably benign Het
Cox7a2l GGA GGATGGGGA 17: 83,502,722 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 CCCAGGGATGTGACAGACACACTG CCCAGGGATGTGACAGACACACTGACCAGGGATGTGACAGACACACTG 9: 87,040,417 probably benign Het
Cyb5r4 GA GATGTGACAGACACACTGCCCAGGTA 9: 87,040,447 probably null Het
Dnmt1 GGGCGGAGCACAGTTCCTACCTCGTT GGGCGGAGCACAGTTCCTACCTCGTTTTGGTGGCGGAGCACAGTTCCTACCTCGTT 9: 20,910,120 probably null Het
Fam71e1 GGGTCTGAGGGAGGA GGGTCTGAGGGAGGAAGGCTGGATCCTGGATACCTAGGTCTGAGGGAGGA 7: 44,500,523 probably null Het
Fbrsl1 GTG GTGCGTGTGCTGTTG 5: 110,378,149 probably benign Het
Frem3 GATC GATCATC 8: 80,615,238 probably benign Het
Gabre GCTC GCTCTGTCTC X: 72,270,762 probably benign Het
Gm15155 CAA CAACAACAAA X: 156,345,640 probably null Het
Igf1r GGAGATGGAGC GGAGATGGAGCTAGAGATGGAGC 7: 68,226,176 probably benign Het
Krtap28-10 CACCACAGC CACCACAGCCACAGCGACCACAGC 1: 83,042,282 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,835 probably benign Het
Map1a CCAGCTCCAGCTCCA CCAGCTCCAGCTCCAGCTACAGCTCCAGATACAGCTCCAGCTCCA 2: 121,306,304 probably benign Het
Map1a GCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCA 2: 121,306,307 probably benign Het
Neu1 TCTTCTA T 17: 34,932,558 probably benign Het
Nolc1 CAGCAGC CAGCAGCAGAAGCAGC 19: 46,081,371 probably benign Het
Olfr850 G T 9: 19,477,632 A206E possibly damaging Het
Pdik1l TTTT TTTTGTTTTTGGTTT 4: 134,279,374 probably null Het
Rassf6 CACTCATGGTCCTGTAGAGCAATGGGGATTC CACTCATGGTCCTGTAGAGCAATGGGGATTCTGCCTGACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,912 probably benign Het
Rassf6 ATGGTCCTGTAGAGCAATGGGGATTC ATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACTCGTGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,917 probably benign Het
Rassf6 CTGTAGAGCAATGGGGATTC CTGTAGAGCAATGGGGATTCTGCCTCACTCATGGTCATGTAGAGCAATGGGGATTC 5: 90,608,923 probably benign Het
Rpgrip1 AGAGGAGGA AGA 14: 52,149,526 probably benign Het
Rprd2 AGAGCCTGTGGTGCTCGCAGGGGAGGCTGTGGTGCTC AGAGGCTGTGGTGCTC 3: 95,766,320 probably benign Het
Rsf1 CG CGAGG 7: 97,579,908 probably benign Het
Rtbdn GCGGC GCGGCATCGGC 8: 84,956,175 probably benign Het
Smarca2 CA CACCAAGA 19: 26,631,011 probably benign Het
Tfeb GCA GCACCA 17: 47,786,097 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,098 probably null Het
Tmed6 AGC AGCTGGC 8: 107,061,596 probably null Het
Tomm5 TCTTCCGC TCTTCCGCAGCTTCCGC 4: 45,107,976 probably benign Het
Trappc9 TG TGATGCTGCTGCTGCGG 15: 72,801,298 probably benign Het
Other mutations in Defb22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Defb22 APN 2 152486079 missense possibly damaging 0.93
IGL02040:Defb22 APN 2 152490056 missense possibly damaging 0.83
IGL03159:Defb22 APN 2 152490075 missense probably benign 0.00
R5153:Defb22 UTSW 2 152485802 missense unknown
R5387:Defb22 UTSW 2 152485906 missense unknown
R6141:Defb22 UTSW 2 152485802 missense unknown
R7153:Defb22 UTSW 2 152485920 missense unknown
R7385:Defb22 UTSW 2 152486197 missense probably damaging 0.99
R7650:Defb22 UTSW 2 152486103 missense probably benign 0.40
R7671:Defb22 UTSW 2 152486030 missense unknown
R8242:Defb22 UTSW 2 152486087 missense probably damaging 0.99
R8271:Defb22 UTSW 2 152485792 missense unknown
RF013:Defb22 UTSW 2 152485831 small insertion probably benign
RF021:Defb22 UTSW 2 152485832 small insertion probably benign
RF025:Defb22 UTSW 2 152485823 small insertion probably benign
RF025:Defb22 UTSW 2 152485824 small insertion probably benign
RF029:Defb22 UTSW 2 152485833 small insertion probably benign
RF041:Defb22 UTSW 2 152485823 small insertion probably benign
RF043:Defb22 UTSW 2 152485833 small insertion probably benign
RF062:Defb22 UTSW 2 152485825 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGACTTAGGCCTCTTGG -3'
(R):5'- TCAAAATTAGTGGTCACTGTGGG -3'

Sequencing Primer
(F):5'- CTTGGCTTTAATCAACCAGGG -3'
(R):5'- TCAGATAATCTTGTCACAGCAGG -3'
Posted On2019-12-04